Human PFKFB3/iPFK-2/IPFK2 ORF/cDNA clone-Lentivirus particle (NM_004566.3)
Cat. No.: vGMLP005289
Pre-made Human PFKFB3/iPFK-2/IPFK2 Lentiviral expression plasmid for PFKFB3 lentivirus packaging, PFKFB3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
PFKFB3/iPFK-2 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP005289 | Human PFKFB3 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP005289 |
| Gene Name | PFKFB3 |
| Accession Number | NM_004566.3 |
| Gene ID | 5209 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 1563 bp |
| Gene Alias | iPFK-2,IPFK2,PFK2 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGCCGTTGGAACTGACGCAGAGCCGAGTGCAGAAGATCTGGGTGCCCGTGGACCACAGGCCCTCGTTGCCCAGATCCTGTGGGCCAAAGCTGACCAACTCCCCCACCGTCATCGTCATGGTGGGCCTCCCCGCCCGGGGCAAGACCTACATCTCCAAGAAGCTGACTCGCTACCTCAACTGGATTGGCGTCCCCACAAAAGTGTTCAACGTCGGGGAGTATCGCCGGGAGGCTGTGAAGCAGTACAGCTCCTACAACTTCTTCCGCCCCGACAATGAGGAAGCCATGAAAGTCCGGAAGCAATGTGCCTTAGCTGCCTTGAGAGATGTCAAAAGCTACCTGGCGAAAGAAGGGGGACAAATTGCGGTTTTCGATGCCACCAATACTACTAGAGAGAGGAGACACATGATCCTTCATTTTGCCAAAGAAAATGACTTTAAGGCGTTTTTCATCGAGTCGGTGTGCGACGACCCTACAGTTGTGGCCTCCAATATCATGGAAGTTAAAATCTCCAGCCCGGATTACAAAGACTGCAACTCGGCAGAAGCCATGGACGACTTCATGAAGAGGATCAGTTGCTATGAAGCCAGCTACCAGCCCCTCGACCCCGACAAATGCGACAGGGACTTGTCGCTGATCAAGGTGATTGACGTGGGCCGGAGGTTCCTGGTGAACCGGGTGCAGGACCACATCCAGAGCCGCATCGTGTACTACCTGATGAACATCCACGTGCAGCCGCGTACCATCTACCTGTGCCGGCACGGCGAGAACGAGCACAACCTCCAGGGCCGCATCGGGGGCGACTCAGGCCTGTCCAGCCGGGGCAAGAAGTTTGCCAGTGCTCTGAGCAAGTTCGTGGAGGAGCAGAACCTGAAGGACCTGCGCGTGTGGACCAGCCAGCTGAAGAGCACCATCCAGACGGCCGAGGCGCTGCGGCTGCCCTACGAGCAGTGGAAGGCGCTCAATGAGATCGACGCGGGCGTCTGTGAGGAGCTGACCTACGAGGAGATCAGGGACACCTACCCTGAGGAGTATGCGCTGCGGGAGCAGGACAAGTACTATTACCGCTACCCCACCGGGGAGTCCTACCAGGACCTGGTCCAGCGCTTGGAGCCAGTGATCATGGAGCTGGAGCGGCAGGAGAATGTGCTGGTCATCTGCCACCAGGCCGTCCTGCGCTGCCTGCTTGCCTACTTCCTGGATAAGAGTGCAGAGGAGATGCCCTACCTGAAATGCCCTCTTCACACCGTCCTGAAACTGACGCCTGTCGCTTATGGCTGCCGTGTGGAATCCATCTACCTGAACGTGGAGTCCGTCTGCACACACCGGGAGAGGTCAGAGGATGCAAAGAAGGGACCTAACCCGCTCATGAGACGCAATAGTGTCACCCCGCTAGCCAGCCCCGAACCCACCAAAAAGCCTCGCATCAACAGCTTTGAGGAGCATGTGGCCTCCACCTCGGCCGCCCTGCCCAGCTGCCTGCCCCCGGAGGTGCCCACGCAGCTGCCTGGACAAAACATGAAAGGCTCCCGGAGCAGCGCTGACTCCTCCAGGAAACACTGA |
| ORF Protein Sequence | MPLELTQSRVQKIWVPVDHRPSLPRSCGPKLTNSPTVIVMVGLPARGKTYISKKLTRYLNWIGVPTKVFNVGEYRREAVKQYSSYNFFRPDNEEAMKVRKQCALAALRDVKSYLAKEGGQIAVFDATNTTRERRHMILHFAKENDFKAFFIESVCDDPTVVASNIMEVKISSPDYKDCNSAEAMDDFMKRISCYEASYQPLDPDKCDRDLSLIKVIDVGRRFLVNRVQDHIQSRIVYYLMNIHVQPRTIYLCRHGENEHNLQGRIGGDSGLSSRGKKFASALSKFVEEQNLKDLRVWTSQLKSTIQTAEALRLPYEQWKALNEIDAGVCEELTYEEIRDTYPEEYALREQDKYYYRYPTGESYQDLVQRLEPVIMELERQENVLVICHQAVLRCLLAYFLDKSAEEMPYLKCPLHTVLKLTPVAYGCRVESIYLNVESVCTHRERSEDAKKGPNPLMRRNSVTPLASPEPTKKPRINSFEEHVASTSAALPSCLPPEVPTQLPGQNMKGSRSSADSSRKH |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T23787-Ab | Anti-PFKFB3 monoclonal antibody |
| Target Antigen | GM-Tg-g-T23787-Ag | PFKFB3 protein |
| ORF Viral Vector | pGMLP000744 | Human PFKFB3 Lentivirus plasmid |
| ORF Viral Vector | pGMLP005289 | Human PFKFB3 Lentivirus plasmid |
| ORF Viral Vector | pGMAAV001756 | Human PFKFB3 Adeno-associate virus(AAV) plasmid |
| ORF Viral Vector | vGMLP000744 | Human PFKFB3 Lentivirus particle |
| ORF Viral Vector | vGMLP005289 | Human PFKFB3 Lentivirus particle |
| ORF Viral Vector | vGMAAV001756 | Human PFKFB3 Adeno-associate virus(AAV) particle |
Target information
| Target ID | GM-T23787 |
| Target Name | PFKFB3 |
| Gene ID | 5209, 170768, 713062, 117276, 101100062, 487139, 407183, 100070251 |
| Gene Symbol and Synonyms | E330010H22Rik,iPFK-2,IPFK2,PFK2,PFKFB3,uPFK-2 |
| Uniprot Accession | Q16875 |
| Uniprot Entry Name | F263_HUMAN |
| Protein Sub-location | Introcelluar Protein |
| Category | Therapeutics Target |
| Disease | Not Available |
| Gene Ensembl | ENSG00000170525 |
| Target Classification | Not Available |
The protein encoded by this gene belongs to a family of bifunctional proteins that are involved in both the synthesis and degradation of fructose-2,6-bisphosphate, a regulatory molecule that controls glycolysis in eukaryotes. The encoded protein has a 6-phosphofructo-2-kinase activity that catalyzes the synthesis of fructose-2,6-bisphosphate (F2,6BP), and a fructose-2,6-biphosphatase activity that catalyzes the degradation of F2,6BP. This protein is required for cell cycle progression and prevention of apoptosis. It functions as a regulator of cyclin-dependent kinase 1, linking glucose metabolism to cell proliferation and survival in tumor cells. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2016]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


