Human MAPKAPK3/3PK/MAPKAP-K3 ORF/cDNA clone-Lentivirus plasmid (NM_001243925.1)
Cat. No.: pGMLP005304
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human MAPKAPK3/3PK/MAPKAP-K3 Lentiviral expression plasmid for MAPKAPK3 lentivirus packaging, MAPKAPK3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
MAPKAPK3/3PK products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP005304 |
Gene Name | MAPKAPK3 |
Accession Number | NM_001243925.1 |
Gene ID | 7867 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1149 bp |
Gene Alias | 3PK,MAPKAP-K3,MAPKAP3,MAPKAPK-3,MDPT3,MK-3 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGATGGTGAAACAGCAGAGGAGCAGGGGGGCCCTGTGCCCCCGCCAGTTGCACCCGGCGGACCCGGCTTGGGCGGTGCTCCGGGGGGGCGGCGGGAGCCCAAGAAGTACGCAGTGACCGACGACTACCAGTTGTCCAAGCAGGTGCTGGGCCTGGGTGTGAACGGCAAAGTGCTGGAGTGCTTCCATCGGCGCACTGGACAGAAGTGTGCCCTGAAGCTCCTGTATGACAGCCCCAAGGCCCGGCAGGAGGTAGACCATCACTGGCAGGCTTCTGGCGGCCCCCATATTGTCTGCATCCTGGATGTGTATGAGAACATGCACCATGGCAAGCGCTGTCTCCTCATCATCATGGAATGCATGGAAGGTGGTGAGTTGTTCAGCAGGATTCAGGAGCGTGGCGACCAGGCTTTCACTGAGAGAGAAGCTGCAGAGATAATGCGGGATATTGGCACTGCCATCCAGTTTCTGCACAGCCATAACATTGCCCACCGAGATGTCAAGCCTGAAAACCTACTCTACACATCTAAGGAGAAAGACGCAGTGCTTAAGCTCACCGATTTTGGCTTTGCTAAGGAGACCACCCAAAATGCCCTGCAGACACCCTGCTATACTCCCTATTATGTGGCCCCTGAGGTCCTGGGTCCAGAGAAGTATGACAAGTCATGTGACATGTGGTCCCTGGGTGTCATCATGTACATCCTCCTTTGTGGCTTCCCACCCTTCTACTCCAACACGGGCCAGGCCATCTCCCCGGGGATGAAGAGGAGGATTCGCCTGGGCCAGTACGGCTTCCCCAATCCTGAGTGGTCAGAAGTCTCTGAGGATGCCAAGCAGCTGATCCGCCTCCTGTTGAAGACAGACCCCACAGAGAGGCTGACCATCACTCAGTTCATGAACCACCCCTGGATCAACCAATCGATGGTAGTGCCACAGACCCCACTCCACACGGCCCGAGTGCTGCAGGAGGACAAAGACCACTGGGACGAAGTCAAGGAGGAGATGACCAGTGCCTTGGCCACTATGCGGGTAGACTACGACCAGGTGAAGATCAAGGACCTGAAGACCTCTAACAACCGGCTCCTCAACAAGAGGAGAAAAAAGCAGGCAGGCAGCTCCTCTGCCTCACAGGGCTGCAACAACCAGTAG |
ORF Protein Sequence | MDGETAEEQGGPVPPPVAPGGPGLGGAPGGRREPKKYAVTDDYQLSKQVLGLGVNGKVLECFHRRTGQKCALKLLYDSPKARQEVDHHWQASGGPHIVCILDVYENMHHGKRCLLIIMECMEGGELFSRIQERGDQAFTEREAAEIMRDIGTAIQFLHSHNIAHRDVKPENLLYTSKEKDAVLKLTDFGFAKETTQNALQTPCYTPYYVAPEVLGPEKYDKSCDMWSLGVIMYILLCGFPPFYSNTGQAISPGMKRRIRLGQYGFPNPEWSEVSEDAKQLIRLLLKTDPTERLTITQFMNHPWINQSMVVPQTPLHTARVLQEDKDHWDEVKEEMTSALATMRVDYDQVKIKDLKTSNNRLLNKRRKKQAGSSSASQGCNNQ |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0151-Ab | Anti-MAPKAPK3 monoclonal antibody |
Target Antigen | GM-Tg-g-IP0151-Ag | MAPKAPK3 protein |
ORF Viral Vector | pGMLP005304 | Human MAPKAPK3 Lentivirus plasmid |
ORF Viral Vector | pGMAP000185 | Human MAPKAPK3 Adenovirus plasmid |
ORF Viral Vector | vGMLP005304 | Human MAPKAPK3 Lentivirus particle |
ORF Viral Vector | vGMAP000185 | Human MAPKAPK3 Adenovirus particle |
Target information
Target ID | GM-IP0151 |
Target Name | MAPKAPK3 |
Gene ID | 7867, 102626, 701320, 315994, 101096794, 484756, 615215, 100061475 |
Gene Symbol and Synonyms | 3PK,MAPKAP-K3,MAPKAP3,MAPKAPK-3,MAPKAPK3,MapkKapk3,MDPT3,MK-3,MK3 |
Uniprot Accession | Q16644 |
Uniprot Entry Name | MAPK3_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000114738 |
Target Classification | Not Available |
This gene encodes a member of the Ser/Thr protein kinase family. This kinase functions as a mitogen-activated protein kinase (MAP kinase)- activated protein kinase. MAP kinases are also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals. This kinase was shown to be activated by growth inducers and stress stimulation of cells. In vitro studies demonstrated that ERK, p38 MAP kinase and Jun N-terminal kinase were all able to phosphorylate and activate this kinase, which suggested the role of this kinase as an integrative element of signaling in both mitogen and stress responses. This kinase was reported to interact with, phosphorylate and repress the activity of E47, which is a basic helix-loop-helix transcription factor known to be involved in the regulation of tissue-specific gene expression and cell differentiation. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.