Human MAPKAPK3/3PK/MAPKAP3 ORF/cDNA clone-Adenovirus particle (BC001662)

Cat. No.: vGMAP000185

Pre-made Human MAPKAPK3/3PK/MAPKAP3 Adenovirus for MAPKAPK3 overexpression in-vitro and in-vivo. The MAPKAPK3 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified MAPKAPK3-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to MAPKAPK3/3PK products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000185 Human MAPKAPK3 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000185
Gene Name MAPKAPK3
Accession Number BC001662
Gene ID 7867
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1149 bp
Gene Alias 3PK,MAPKAP3
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGGATGGTGAAACAGCAGAGGAGCAGGGGGGCCCTGTGCCCCCGCCAGTTGCACCCGGCGGACCCGGCTTGGGCGGTGCTCCGGGGGGGCGGCGGGAGCCCAAGAAGTACGCAGTGACCGACGACTACCAGTTGTCCAAGCAGGTGCTGGGCCTGGGTGTGAACGGCAAAGTGCTGGAGTGCTTCCATCGGCGCACTGGACAGAAGTGTGCCCTGAAGCTCCTGTATGACAGCCCCAAGGCCCGGCAGGAGGTAGACCATCACTGGCAGGCTTCTGGCGGCCCCCATATTGTCTGCATCCTGGATGTGTATGAGAACATGCACCATGGCAAGCGCTGTCTCCTCATCATCATGGAATGCATGGAAGGTGGTGAGTTGTTCAGCAGGATTCAGGAGCGTGGCGACCAGGCTTTCACTGAGAGAGAAGCTGCAGAGATAATGCGGGATATTGGCACTGCCATCCAGTTTCTGCACAGCCATAACATTGCCCACCGAGATGTCAAGCCTGAAAACCTACTCTACACATCTAAGGAGAAAGACGCAGTGCTTAAGCTCACCGATTTTGGCTTTGCTAAGGAGACCACCCAAAATGCCCTGCAGACACCCTGCTATACTCCCTATTATGTGGCCCCTGAGGTCCTGGGTCCAGAGAAGTATGACAAGTCATGTGACATGTGGTCCCTGGGTGTCATCATGTACATCCTCCTTTGTGGCTTCCCACCCTTCTACTCCAACACGGGCCAGGCCATCTCCCCGGGGATGAAGAGGAGGATTCGCCTGGGCCAGTACGGCTTCCCCAATCCTGAGTGGTCAGAAGTCTCTGAGGATGCCAAGCAGCTGATCCGCCTCCTGTTGAAGACAGACCCCACAGAGAGGCTGACCATCACTCAGTTCATGAACCACCCCTGGATCAACCAATCGATGGTAGTGCCACAGACCCCACTCCACACGGCCCGAGTGCTGCAGGAGGACAAAGACCACTGGGACGAAGTCAAGGAGGAGATGACCAGTGCCTTGGCCACTATGCGGGTAGACTACGACCAGGTGAAGATCAAGGACCTGAAGACCTCTAACAACCGGCTCCTCAACAAGAGGAGAAAAAAGCAGGCAGGCAGCTCCTCTGCCTCACAGGGCTGCAACAACCAGTAG
ORF Protein Sequence MDGETAEEQGGPVPPPVAPGGPGLGGAPGGRREPKKYAVTDDYQLSKQVLGLGVNGKVLECFHRRTGQKCALKLLYDSPKARQEVDHHWQASGGPHIVCILDVYENMHHGKRCLLIIMECMEGGELFSRIQERGDQAFTEREAAEIMRDIGTAIQFLHSHNIAHRDVKPENLLYTSKEKDAVLKLTDFGFAKETTQNALQTPCYTPYYVAPEVLGPEKYDKSCDMWSLGVIMYILLCGFPPFYSNTGQAISPGMKRRIRLGQYGFPNPEWSEVSEDAKQLIRLLLKTDPTERLTITQFMNHPWINQSMVVPQTPLHTARVLQEDKDHWDEVKEEMTSALATMRVDYDQVKIKDLKTSNNRLLNKRRKKQAGSSSASQGCNNQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0151-Ab Anti-MAPKAPK3 monoclonal antibody
    Target Antigen GM-Tg-g-IP0151-Ag MAPKAPK3 protein
    ORF Viral Vector pGMLP005304 Human MAPKAPK3 Lentivirus plasmid
    ORF Viral Vector pGMAP000185 Human MAPKAPK3 Adenovirus plasmid
    ORF Viral Vector vGMLP005304 Human MAPKAPK3 Lentivirus particle
    ORF Viral Vector vGMAP000185 Human MAPKAPK3 Adenovirus particle


    Target information

    Target ID GM-IP0151
    Target Name MAPKAPK3
    Gene ID 7867, 102626, 701320, 315994, 101096794, 484756, 615215, 100061475
    Gene Symbol and Synonyms 3PK,MAPKAP-K3,MAPKAP3,MAPKAPK-3,MAPKAPK3,MapkKapk3,MDPT3,MK-3,MK3
    Uniprot Accession Q16644
    Uniprot Entry Name MAPK3_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000114738
    Target Classification Not Available

    This gene encodes a member of the Ser/Thr protein kinase family. This kinase functions as a mitogen-activated protein kinase (MAP kinase)- activated protein kinase. MAP kinases are also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals. This kinase was shown to be activated by growth inducers and stress stimulation of cells. In vitro studies demonstrated that ERK, p38 MAP kinase and Jun N-terminal kinase were all able to phosphorylate and activate this kinase, which suggested the role of this kinase as an integrative element of signaling in both mitogen and stress responses. This kinase was reported to interact with, phosphorylate and repress the activity of E47, which is a basic helix-loop-helix transcription factor known to be involved in the regulation of tissue-specific gene expression and cell differentiation. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.