Human PIKFYVE/CFD/FAB1 ORF/cDNA clone-Lentivirus plasmid (NM_152671.3)
Cat. No.: pGMLP005318
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human PIKFYVE/CFD/FAB1 Lentiviral expression plasmid for PIKFYVE lentivirus packaging, PIKFYVE lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
PIP5K3/PIKFYVE/CFD products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP005318 |
Gene Name | PIKFYVE |
Accession Number | NM_152671.3 |
Gene ID | 200576 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1356 bp |
Gene Alias | CFD,FAB1,HEL37,PIP5K,PIP5K3,ZFYVE29 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCCACAGATGATAAGACGTCCCCAACACTGGACTCTGCTAATGATTTGCCTCGATCTCCTACTAGTCCTTCTCATCTCACACACTTTAAACCTTTGACTCCTGATCAAGATGAGCCCCCTTTTAAATCAGCTTATAGTTCTTTTGTAAATCTCTTTCGTTTTAACAAAGAGAGAGCAGAAGGAGGCCAGGGAGAACAGCAGCCTTTGAGTGGAAGTTGGACCAGCCCTCAGCTCCCTTCGAGGACACAGTCTGTTAGGTCACCCACACCTTATAAAAAGCAGCTTAATGAGGAACTCCAGCGGCGCTCTTCAGCATTAGGAGACCTCCGAGCTTGCACATATTGTAGAAAAATAGCCTTAAGTTATGCTCATTCCACAGACAGTAATTCTATTGGGGAAGACTTGAATGCTCTTTCAGATTCTGCTTGCTCTGTGTCTGTGCTTGATCCAAGTGAACCCCGAACACCTGTTGGGAGTAGGAAAGCCAGCCGTAACATATTTTTAGAGGATGATTTGGCCTGGCAAAGTTTGATTCATCCAGATTCCTCAAATACTCCTCTTTCAACAAGACTTGTATCTGTGCAAGAGGATGCTGGGAAATCTCCTGCTCGAAATAGATCAGCCAGCATTACTAACCTGTCACTGGATAGATCTGGTTCTCCTATGGTACCTTCATATGAGACATCTGTCAGTCCCCAGGCTAACCGAACATATGTTAGGACAGAGACCACTGAGGATGAACGCAAAATTCTTCTGGACAGTGTGCAGTTAAAAGACCTGTGGAAAAAAATCTGCCATCACAGCAGTGGAATGGAGTTTCAGGATCACCGCTACTGGTTGAGAACGCATCCCAACTGCATTGTAGGAAAGGAATTAGTCAACTGGCTAATCCGAAATGGGCATATTGCCACAAGGGCACAAGCTATAGCAATTGGACAAGCAATGGTTGATGGACGTTGGCTGGATTGTGTTAGTCATCACGACCAGCTTTTCAGAGATGAGTATGCGCTGTATAGACCACTGCAGAGTACAGAATTTTCTGAGACGCCTTCTCCCGACAGTGACTCAGTGAACTCCGTGGAAGGACACTCTGAGCCATCCTGGTTTAAAGACATAAAGTTTGATGACAGTGACACAGAACAGATAGCTGAAGAAGGTGACGATAATTTGGCTAATTCTGCCAGTCCTAGCAAGCGCACATCAGTCAGCAGTTTCCAGTCCACAGTGGACAGTGACTCAGCCGCTTCTATCAGCCTGAACGTGGAGCTGGACAACGTGAACTTCCATATCAAGAAGCCCTCCAAGTACCCACATGTGCCCCCTCACCCTGCTGACCAAAAAGGTAGGAGGTAG |
ORF Protein Sequence | MATDDKTSPTLDSANDLPRSPTSPSHLTHFKPLTPDQDEPPFKSAYSSFVNLFRFNKERAEGGQGEQQPLSGSWTSPQLPSRTQSVRSPTPYKKQLNEELQRRSSALGDLRACTYCRKIALSYAHSTDSNSIGEDLNALSDSACSVSVLDPSEPRTPVGSRKASRNIFLEDDLAWQSLIHPDSSNTPLSTRLVSVQEDAGKSPARNRSASITNLSLDRSGSPMVPSYETSVSPQANRTYVRTETTEDERKILLDSVQLKDLWKKICHHSSGMEFQDHRYWLRTHPNCIVGKELVNWLIRNGHIATRAQAIAIGQAMVDGRWLDCVSHHDQLFRDEYALYRPLQSTEFSETPSPDSDSVNSVEGHSEPSWFKDIKFDDSDTEQIAEEGDDNLANSASPSKRTSVSSFQSTVDSDSAASISLNVELDNVNFHIKKPSKYPHVPPHPADQKGRR |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T02469-Ab | Anti-PIP5K3 monoclonal antibody |
Target Antigen | GM-Tg-g-T02469-Ag | PIP5K3/PIKFYVE protein |
ORF Viral Vector | pGMLP005318 | Human PIKFYVE Lentivirus plasmid |
ORF Viral Vector | vGMLP005318 | Human PIKFYVE Lentivirus particle |
Target information
Target ID | GM-T02469 |
Target Name | PIP5K3 |
Gene ID | 200576, 18711, 710115, 316457, 101094121, 478890, 790873, 100066445 |
Gene Symbol and Synonyms | 5230400C17Rik,CFD,FAB1,fab1-like,HEL37,p235,PIKFYVE,PIP5K,PIP5K3,Pipk5k3,PipkIII,ZFYVE29 |
Uniprot Accession | Q9Y2I7 |
Uniprot Entry Name | FYV1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000115020 |
Target Classification | Kinase |
Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. The protein plays a key role in cell entry of ebola virus and SARS-CoV-2 by endocytosis Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. [provided by RefSeq, Jul 2021]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.