Human PIKFYVE/CFD/FAB1 ORF/cDNA clone-Lentivirus particle (NM_152671.3)

Cat. No.: vGMLP005318

Pre-made Human PIKFYVE/CFD/FAB1 Lentiviral expression plasmid for PIKFYVE lentivirus packaging, PIKFYVE lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to PIP5K3/PIKFYVE/CFD products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP005318 Human PIKFYVE Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP005318
Gene Name PIKFYVE
Accession Number NM_152671.3
Gene ID 200576
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1356 bp
Gene Alias CFD,FAB1,HEL37,PIP5K,PIP5K3,ZFYVE29
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCACAGATGATAAGACGTCCCCAACACTGGACTCTGCTAATGATTTGCCTCGATCTCCTACTAGTCCTTCTCATCTCACACACTTTAAACCTTTGACTCCTGATCAAGATGAGCCCCCTTTTAAATCAGCTTATAGTTCTTTTGTAAATCTCTTTCGTTTTAACAAAGAGAGAGCAGAAGGAGGCCAGGGAGAACAGCAGCCTTTGAGTGGAAGTTGGACCAGCCCTCAGCTCCCTTCGAGGACACAGTCTGTTAGGTCACCCACACCTTATAAAAAGCAGCTTAATGAGGAACTCCAGCGGCGCTCTTCAGCATTAGGAGACCTCCGAGCTTGCACATATTGTAGAAAAATAGCCTTAAGTTATGCTCATTCCACAGACAGTAATTCTATTGGGGAAGACTTGAATGCTCTTTCAGATTCTGCTTGCTCTGTGTCTGTGCTTGATCCAAGTGAACCCCGAACACCTGTTGGGAGTAGGAAAGCCAGCCGTAACATATTTTTAGAGGATGATTTGGCCTGGCAAAGTTTGATTCATCCAGATTCCTCAAATACTCCTCTTTCAACAAGACTTGTATCTGTGCAAGAGGATGCTGGGAAATCTCCTGCTCGAAATAGATCAGCCAGCATTACTAACCTGTCACTGGATAGATCTGGTTCTCCTATGGTACCTTCATATGAGACATCTGTCAGTCCCCAGGCTAACCGAACATATGTTAGGACAGAGACCACTGAGGATGAACGCAAAATTCTTCTGGACAGTGTGCAGTTAAAAGACCTGTGGAAAAAAATCTGCCATCACAGCAGTGGAATGGAGTTTCAGGATCACCGCTACTGGTTGAGAACGCATCCCAACTGCATTGTAGGAAAGGAATTAGTCAACTGGCTAATCCGAAATGGGCATATTGCCACAAGGGCACAAGCTATAGCAATTGGACAAGCAATGGTTGATGGACGTTGGCTGGATTGTGTTAGTCATCACGACCAGCTTTTCAGAGATGAGTATGCGCTGTATAGACCACTGCAGAGTACAGAATTTTCTGAGACGCCTTCTCCCGACAGTGACTCAGTGAACTCCGTGGAAGGACACTCTGAGCCATCCTGGTTTAAAGACATAAAGTTTGATGACAGTGACACAGAACAGATAGCTGAAGAAGGTGACGATAATTTGGCTAATTCTGCCAGTCCTAGCAAGCGCACATCAGTCAGCAGTTTCCAGTCCACAGTGGACAGTGACTCAGCCGCTTCTATCAGCCTGAACGTGGAGCTGGACAACGTGAACTTCCATATCAAGAAGCCCTCCAAGTACCCACATGTGCCCCCTCACCCTGCTGACCAAAAAGGTAGGAGGTAG
ORF Protein Sequence MATDDKTSPTLDSANDLPRSPTSPSHLTHFKPLTPDQDEPPFKSAYSSFVNLFRFNKERAEGGQGEQQPLSGSWTSPQLPSRTQSVRSPTPYKKQLNEELQRRSSALGDLRACTYCRKIALSYAHSTDSNSIGEDLNALSDSACSVSVLDPSEPRTPVGSRKASRNIFLEDDLAWQSLIHPDSSNTPLSTRLVSVQEDAGKSPARNRSASITNLSLDRSGSPMVPSYETSVSPQANRTYVRTETTEDERKILLDSVQLKDLWKKICHHSSGMEFQDHRYWLRTHPNCIVGKELVNWLIRNGHIATRAQAIAIGQAMVDGRWLDCVSHHDQLFRDEYALYRPLQSTEFSETPSPDSDSVNSVEGHSEPSWFKDIKFDDSDTEQIAEEGDDNLANSASPSKRTSVSSFQSTVDSDSAASISLNVELDNVNFHIKKPSKYPHVPPHPADQKGRR

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T02469-Ab Anti-PIP5K3 monoclonal antibody
    Target Antigen GM-Tg-g-T02469-Ag PIP5K3/PIKFYVE protein
    ORF Viral Vector pGMLP005318 Human PIKFYVE Lentivirus plasmid
    ORF Viral Vector vGMLP005318 Human PIKFYVE Lentivirus particle


    Target information

    Target ID GM-T02469
    Target Name PIP5K3
    Gene ID 200576, 18711, 710115, 316457, 101094121, 478890, 790873, 100066445
    Gene Symbol and Synonyms 5230400C17Rik,CFD,FAB1,fab1-like,HEL37,p235,PIKFYVE,PIP5K,PIP5K3,Pipk5k3,PipkIII,ZFYVE29
    Uniprot Accession Q9Y2I7
    Uniprot Entry Name FYV1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000115020
    Target Classification Kinase

    Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. The protein plays a key role in cell entry of ebola virus and SARS-CoV-2 by endocytosis Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. [provided by RefSeq, Jul 2021]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.