Human PTK6/BRK ORF/cDNA clone-Lentivirus plasmid (NM_005975.3)
Cat. No.: pGMLP005351
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human PTK6/BRK Lentiviral expression plasmid for PTK6 lentivirus packaging, PTK6 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
PTK6/BRK products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP005351 |
Gene Name | PTK6 |
Accession Number | NM_005975.3 |
Gene ID | 5753 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1356 bp |
Gene Alias | BRK |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGTGTCCCGGGACCAGGCTCACCTGGGCCCCAAGTATGTGGGCCTCTGGGACTTCAAGTCCCGGACGGACGAGGAGCTGAGCTTCCGCGCGGGGGACGTCTTCCACGTGGCCAGGAAGGAGGAGCAGTGGTGGTGGGCCACGCTGCTGGACGAGGCGGGTGGGGCCGTGGCCCAGGGCTATGTGCCCCACAACTACCTGGCCGAGAGGGAGACGGTGGAGTCGGAACCGTGGTTCTTTGGCTGCATCTCCCGCTCGGAAGCTGTGCGTCGGCTGCAGGCCGAGGGCAACGCCACGGGCGCCTTCCTGATCAGGGTCAGCGAGAAGCCGAGTGCCGACTACGTCCTGTCGGTGCGGGACACGCAGGCTGTGCGGCACTACAAGATCTGGCGGCGTGCCGGGGGCCGGCTGCACCTGAACGAGGCGGTGTCCTTCCTCAGCCTGCCCGAGCTTGTGAACTACCACAGGGCCCAGAGCCTGTCCCACGGCCTGCGGCTGGCCGCGCCCTGCCGGAAGCACGAGCCTGAGCCCCTGCCCCATTGGGATGACTGGGAGAGGCCGAGGGAGGAGTTCACGCTCTGCAGGAAGCTGGGGTCCGGCTACTTTGGGGAGGTCTTCGAGGGGCTCTGGAAAGACCGGGTCCAGGTGGCCATTAAGGTGATTTCTCGAGACAACCTCCTGCACCAGCAGATGCTGCAGTCGGAGATCCAGGCCATGAAGAAGCTGCGGCACAAACACATCCTGGCGCTGTACGCCGTGGTGTCCGTGGGGGACCCCGTGTACATCATCACGGAGCTCATGGCCAAGGGCAGCCTGCTGGAGCTGCTCCGCGACTCTGATGAGAAAGTCCTGCCCGTTTCGGAGCTGCTGGACATCGCCTGGCAGGTGGCTGAGGGCATGTGTTACCTGGAGTCGCAGAATTACATCCACCGGGACCTGGCCGCCAGGAACATCCTCGTCGGGGAAAACACCCTCTGCAAAGTTGGGGACTTCGGGTTAGCCAGGCTTATCAAGGAGGACGTCTACCTCTCCCATGACCACAATATCCCCTACAAGTGGACGGCCCCTGAAGCGCTCTCCCGAGGCCATTACTCCACCAAATCCGACGTCTGGTCCTTTGGGATTCTCCTGCATGAGATGTTCAGCAGGGGTCAGGTGCCCTACCCAGGCATGTCCAACCATGAGGCCTTCCTGAGGGTGGACGCCGGCTACCGCATGCCCTGCCCTCTGGAGTGCCCGCCCAGCGTGCACAAGCTGATGCTGACATGCTGGTGCAGGGACCCCGAGCAGAGACCCTGCTTCAAGGCCCTGCGGGAGAGGCTCTCCAGCTTCACCAGCTACGAGAACCCGACCTGA |
ORF Protein Sequence | MVSRDQAHLGPKYVGLWDFKSRTDEELSFRAGDVFHVARKEEQWWWATLLDEAGGAVAQGYVPHNYLAERETVESEPWFFGCISRSEAVRRLQAEGNATGAFLIRVSEKPSADYVLSVRDTQAVRHYKIWRRAGGRLHLNEAVSFLSLPELVNYHRAQSLSHGLRLAAPCRKHEPEPLPHWDDWERPREEFTLCRKLGSGYFGEVFEGLWKDRVQVAIKVISRDNLLHQQMLQSEIQAMKKLRHKHILALYAVVSVGDPVYIITELMAKGSLLELLRDSDEKVLPVSELLDIAWQVAEGMCYLESQNYIHRDLAARNILVGENTLCKVGDFGLARLIKEDVYLSHDHNIPYKWTAPEALSRGHYSTKSDVWSFGILLHEMFSRGQVPYPGMSNHEAFLRVDAGYRMPCPLECPPSVHKLMLTCWCRDPEQRPCFKALRERLSSFTSYENPT |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T73694-Ab | Anti-PTK6/ BRK monoclonal antibody |
Target Antigen | GM-Tg-g-T73694-Ag | PTK6 VLP (virus-like particle) |
ORF Viral Vector | pGMLP005351 | Human PTK6 Lentivirus plasmid |
ORF Viral Vector | pGMLV001111 | Human PTK6 Lentivirus plasmid |
ORF Viral Vector | pGMPC001519 | Human PTK6 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLP005351 | Human PTK6 Lentivirus particle |
ORF Viral Vector | vGMLV001111 | Human PTK6 Lentivirus particle |
Target information
Target ID | GM-T73694 |
Target Name | PTK6 |
Gene ID | 5753, 20459, 719598, 366275, 101100294, 529814, 100060532 |
Gene Symbol and Synonyms | BRK,PTK6,Sik,tks,Tksk |
Uniprot Accession | Q13882 |
Uniprot Entry Name | PTK6_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000101213 |
Target Classification | Kinase, Tumor-associated antigen (TAA) |
The protein encoded by this gene is a cytoplasmic nonreceptor protein kinase which may function as an intracellular signal transducer in epithelial tissues. Overexpression of this gene in mammary epithelial cells leads to sensitization of the cells to epidermal growth factor and results in a partially transformed phenotype. Expression of this gene has been detected at low levels in some breast tumors but not in normal breast tissue. The encoded protein has been shown to undergo autophosphorylation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.