Human MAPK3/ERK-1/ERK1 ORF/cDNA clone-Lentivirus plasmid (NM_002746.2)

Cat. No.: pGMLP005482
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human MAPK3/ERK-1/ERK1 Lentiviral expression plasmid for MAPK3 lentivirus packaging, MAPK3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to ERK1/MAPK3/ERK-1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $619.2
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP005482
Gene Name MAPK3
Accession Number NM_002746.2
Gene ID 5595
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1140 bp
Gene Alias ERK-1,ERK1,ERT2,HS44KDAP,HUMKER1A,p44-ERK1,p44-MAPK,P44ERK1,P44MAPK,PRKM3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGGCGGCGGCGGCTCAGGGGGGCGGGGGCGGGGAGCCCCGTAGAACCGAGGGGGTCGGCCCGGGGGTCCCGGGGGAGGTGGAGATGGTGAAGGGGCAGCCGTTCGACGTGGGCCCGCGCTACACGCAGTTGCAGTACATCGGCGAGGGCGCGTACGGCATGGTCAGCTCGGCCTATGACCACGTGCGCAAGACTCGCGTGGCCATCAAGAAGATCAGCCCCTTCGAACATCAGACCTACTGCCAGCGCACGCTCCGGGAGATCCAGATCCTGCTGCGCTTCCGCCATGAGAATGTCATCGGCATCCGAGACATTCTGCGGGCGTCCACCCTGGAAGCCATGAGAGATGTCTACATTGTGCAGGACCTGATGGAGACTGACCTGTACAAGTTGCTGAAAAGCCAGCAGCTGAGCAATGACCATATCTGCTACTTCCTCTACCAGATCCTGCGGGGCCTCAAGTACATCCACTCCGCCAACGTGCTCCACCGAGATCTAAAGCCCTCCAACCTGCTCATCAACACCACCTGCGACCTTAAGATTTGTGATTTCGGCCTGGCCCGGATTGCCGATCCTGAGCATGACCACACCGGCTTCCTGACGGAGTATGTGGCTACGCGCTGGTACCGGGCCCCAGAGATCATGCTGAACTCCAAGGGCTATACCAAGTCCATCGACATCTGGTCTGTGGGCTGCATTCTGGCTGAGATGCTCTCTAACCGGCCCATCTTCCCTGGCAAGCACTACCTGGATCAGCTCAACCACATTCTGGGCATCCTGGGCTCCCCATCCCAGGAGGACCTGAATTGTATCATCAACATGAAGGCCCGAAACTACCTACAGTCTCTGCCCTCCAAGACCAAGGTGGCTTGGGCCAAGCTTTTCCCCAAGTCAGACTCCAAAGCCCTTGACCTGCTGGACCGGATGTTAACCTTTAACCCCAATAAACGGATCACAGTGGAGGAAGCGCTGGCTCACCCCTACCTGGAGCAGTACTATGACCCGACGGATGAGCCAGTGGCCGAGGAGCCCTTCACCTTCGCCATGGAGCTGGATGACCTACCTAAGGAGCGGCTGAAGGAGCTCATCTTCCAGGAGACAGCACGCTTCCAGCCCGGAGTGCTGGAGGCCCCCTAG
ORF Protein Sequence MAAAAAQGGGGGEPRRTEGVGPGVPGEVEMVKGQPFDVGPRYTQLQYIGEGAYGMVSSAYDHVRKTRVAIKKISPFEHQTYCQRTLREIQILLRFRHENVIGIRDILRASTLEAMRDVYIVQDLMETDLYKLLKSQQLSNDHICYFLYQILRGLKYIHSANVLHRDLKPSNLLINTTCDLKICDFGLARIADPEHDHTGFLTEYVATRWYRAPEIMLNSKGYTKSIDIWSVGCILAEMLSNRPIFPGKHYLDQLNHILGILGSPSQEDLNCIINMKARNYLQSLPSKTKVAWAKLFPKSDSKALDLLDRMLTFNPNKRITVEEALAHPYLEQYYDPTDEPVAEEPFTFAMELDDLPKERLKELIFQETARFQPGVLEAP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T23276-Ab Anti-ERK1 monoclonal antibody
    Target Antigen GM-Tg-g-T23276-Ag ERK1/MAPK3 protein
    ORF Viral Vector pGMLP005482 Human MAPK3 Lentivirus plasmid
    ORF Viral Vector pGMLP005593 Human MAPK3 Lentivirus plasmid
    ORF Viral Vector pGMLP-SPh-054 Human MAPK3 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-194 Human MAPK3 Adenovirus plasmid
    ORF Viral Vector vGMLP005482 Human MAPK3 Lentivirus particle
    ORF Viral Vector vGMLP005593 Human MAPK3 Lentivirus particle
    ORF Viral Vector vGMLP-SPh-054 Human MAPK3 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-194 Human MAPK3 Adenovirus particle


    Target information

    Target ID GM-T23276
    Target Name ERK1
    Gene ID 5595, 26417, 708938, 50689, 101087958, 100855877, 531391, 100066173
    Gene Symbol and Synonyms ERK-1,ERK1,ERT2,Esrk1,HS44KDAP,HUMKER1A,MAPK1,MAPK3,Mnk1,Mtap2k,p44,p44-ERK1,p44-MAPK,P44ERK1,P44MAPK,PRKM3
    Uniprot Accession P27361
    Uniprot Entry Name MK03_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease IgA glomerulonephritis
    Gene Ensembl ENSG00000102882
    Target Classification Kinase

    The protein encoded by this gene is a member of the MAP kinase family. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act in a signaling cascade that regulates various cellular processes such as proliferation, differentiation, and cell cycle progression in response to a variety of extracellular signals. This kinase is activated by upstream kinases, resulting in its translocation to the nucleus where it phosphorylates nuclear targets. Alternatively spliced transcript variants encoding different protein isoforms have been described. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.