Human AURKA/AIK/ARK1 ORF/cDNA clone-Lentivirus plasmid (NM_001323304.1)

Cat. No.: pGMLP005492
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human AURKA/AIK/ARK1 Lentiviral expression plasmid for AURKA lentivirus packaging, AURKA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to AURKA/AIK products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $639.36
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP005492
Gene Name AURKA
Accession Number NM_001323304.1
Gene ID 6790
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1212 bp
Gene Alias AIK,ARK1,AURA,BTAK,PPP1R47,STK15,STK6,STK7
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGACCGATCTAAAGAAAACTGCATTTCAGGACCTGTTAAGGCTACAGCTCCAGTTGGAGGTCCAAAACGTGTTCTCGTGACTCAGCAATTTCCTTGTCAGAATCCATTACCTGTAAATAGTGGCCAGGCTCAGCGGGTCTTGTGTCCTTCAAATTCTTCCCAGCGCATTCCTTTGCAAGCACAAAAGCTTGTCTCCAGTCACAAGCCGGTTCAGAATCAGAAGCAGAAGCAATTGCAGGCAACCAGTGTACCTCATCCTGTCTCCAGGCCACTGAATAACACCCAAAAGAGCAAGCAGCCCCTGCCATCGGCACCTGAAAATAATCCTGAGGAGGAACTGGCATCAAAACAGAAAAATGAAGAATCAAAAAAGAGGCAGTGGGCTTTGGAAGACTTTGAAATTGGTCGCCCTCTGGGTAAAGGAAAGTTTGGTAATGTTTATTTGGCAAGAGAAAAGCAAAGCAAGTTTATTCTGGCTCTTAAAGTGTTATTTAAAGCTCAGCTGGAGAAAGCCGGAGTGGAGCATCAGCTCAGAAGAGAAGTAGAAATACAGTCCCACCTTCGGCATCCTAATATTCTTAGACTGTATGGTTATTTCCATGATGCTACCAGAGTCTACCTAATTCTGGAATATGCACCACTTGGAACAGTTTATAGAGAACTTCAGAAACTTTCAAAGTTTGATGAGCAGAGAACTGCTACTTATATAACAGAATTGGCAAATGCCCTGTCTTACTGTCATTCGAAGAGAGTTATTCATAGAGACATTAAGCCAGAGAACTTACTTCTTGGATCAGCTGGAGAGCTTAAAATTGCAGATTTTGGGTGGTCAGTACATGCTCCATCTTCCAGGAGGACCACTCTCTGTGGCACCCTGGACTACCTGCCCCCTGAAATGATTGAAGGTCGGATGCATGATGAGAAGGTGGATCTCTGGAGCCTTGGAGTTCTTTGCTATGAATTTTTAGTTGGGAAGCCTCCTTTTGAGGCAAACACATACCAAGAGACCTACAAAAGAATATCACGGGTTGAATTCACATTCCCTGACTTTGTAACAGAGGGAGCCAGGGACCTCATTTCAAGACTGTTGAAGCATAATCCCAGCCAGAGGCCAATGCTCAGAGAAGTACTTGAACACCCCTGGATCACAGCAAATTCATCAAAACCATCAAATTGCCAAAACAAAGAATCAGCTAGCAAACAGTCTTAG
ORF Protein Sequence MDRSKENCISGPVKATAPVGGPKRVLVTQQFPCQNPLPVNSGQAQRVLCPSNSSQRIPLQAQKLVSSHKPVQNQKQKQLQATSVPHPVSRPLNNTQKSKQPLPSAPENNPEEELASKQKNEESKKRQWALEDFEIGRPLGKGKFGNVYLAREKQSKFILALKVLFKAQLEKAGVEHQLRREVEIQSHLRHPNILRLYGYFHDATRVYLILEYAPLGTVYRELQKLSKFDEQRTATYITELANALSYCHSKRVIHRDIKPENLLLGSAGELKIADFGWSVHAPSSRRTTLCGTLDYLPPEMIEGRMHDEKVDLWSLGVLCYEFLVGKPPFEANTYQETYKRISRVEFTFPDFVTEGARDLISRLLKHNPSQRPMLREVLEHPWITANSSKPSNCQNKESASKQS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T87675-Ab Anti-AURKA monoclonal antibody
    Target Antigen GM-Tg-g-T87675-Ag AURKA protein
    ORF Viral Vector pGMLP005492 Human AURKA Lentivirus plasmid
    ORF Viral Vector pGMLV001216 Human AURKA Lentivirus plasmid
    ORF Viral Vector vGMLP005492 Human AURKA Lentivirus particle
    ORF Viral Vector vGMLV001216 Human AURKA Lentivirus particle


    Target information

    Target ID GM-T87675
    Target Name AURKA
    Gene ID 6790, 20878, 698190, 261730, 101091184, 485940, 504437, 100050161
    Gene Symbol and Synonyms AIK,AIRK1,ARK-1,ARK1,AURA,AURKA,Aurora-A,Ayk1,BTAK,IAK,IAK1,PPP1R47,STK15,STK6,STK7
    Uniprot Accession O14965
    Uniprot Entry Name AURKA_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000087586
    Target Classification Kinase, Tumor-associated antigen (TAA)

    The protein encoded by this gene is a cell cycle-regulated kinase that appears to be involved in microtubule formation and/or stabilization at the spindle pole during chromosome segregation. The encoded protein is found at the centrosome in interphase cells and at the spindle poles in mitosis. This gene may play a role in tumor development and progression. A processed pseudogene of this gene has been found on chromosome 1, and an unprocessed pseudogene has been found on chromosome 10. Multiple transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.