Human DUSP1/CL100/HVH1 ORF/cDNA clone-Lentivirus plasmid (NM_004417.3)

Cat. No.: pGMLP005620
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human DUSP1/CL100/HVH1 Lentiviral expression plasmid for DUSP1 lentivirus packaging, DUSP1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to DUSP1/CL100 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $609.12
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP005620
Gene Name DUSP1
Accession Number NM_004417.3
Gene ID 1843
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1104 bp
Gene Alias CL100,HVH1,MKP-1,MKP1,PTPN10
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGTCATGGAAGTGGGCACCCTGGACGCTGGAGGCCTGCGGGCGCTGCTGGGGGAGCGAGCGGCGCAATGCCTGCTGCTGGACTGCCGCTCCTTCTTCGCTTTCAACGCCGGCCACATCGCCGGCTCTGTCAACGTGCGCTTCAGCACCATCGTGCGGCGCCGGGCCAAGGGCGCCATGGGCCTGGAGCACATCGTGCCCAACGCCGAGCTCCGCGGCCGCCTGCTGGCCGGCGCCTACCACGCCGTGGTGTTGCTGGACGAGCGCAGCGCCGCCCTGGACGGCGCCAAGCGCGACGGCACCCTGGCCCTGGCGGCCGGCGCGCTCTGCCGCGAGGCGCGCGCCGCGCAAGTCTTCTTCCTCAAAGGAGGATACGAAGCGTTTTCGGCTTCCTGCCCGGAGCTGTGCAGCAAACAGTCGACCCCCATGGGGCTCAGCCTTCCCCTGAGTACTAGCGTCCCTGACAGCGCGGAATCTGGGTGCAGTTCCTGCAGTACCCCACTCTACGATCAGGGTGGCCCGGTGGAAATCCTGCCCTTTCTGTACCTGGGCAGTGCGTATCACGCTTCCCGCAAGGACATGCTGGATGCCTTGGGCATCACTGCCTTGATCAACGTCTCAGCCAATTGTCCCAACCATTTTGAGGGTCACTACCAGTACAAGAGCATCCCTGTGGAGGACAACCACAAGGCAGACATCAGCTCCTGGTTCAACGAGGCCATTGACTTCATAGACTCCATCAAGAATGCTGGAGGAAGGGTGTTTGTCCACTGCCAGGCAGGCATTTCCCGGTCAGCCACCATCTGCCTTGCTTACCTTATGAGGACTAATCGAGTCAAGCTGGACGAGGCCTTTGAGTTTGTGAAGCAGAGGCGAAGCATCATCTCTCCCAACTTCAGCTTCATGGGCCAGCTGCTGCAGTTTGAGTCCCAGGTGCTGGCTCCGCACTGTTCGGCAGAGGCTGGGAGCCCCGCCATGGCTGTGCTCGACCGAGGCACCTCCACCACCACCGTGTTCAACTTCCCCGTCTCCATCCCTGTCCACTCCACGAACAGTGCGCTGAGCTACCTTCAGAGCCCCATTACGACCTCTCCCAGCTGCTGA
ORF Protein Sequence MVMEVGTLDAGGLRALLGERAAQCLLLDCRSFFAFNAGHIAGSVNVRFSTIVRRRAKGAMGLEHIVPNAELRGRLLAGAYHAVVLLDERSAALDGAKRDGTLALAAGALCREARAAQVFFLKGGYEAFSASCPELCSKQSTPMGLSLPLSTSVPDSAESGCSSCSTPLYDQGGPVEILPFLYLGSAYHASRKDMLDALGITALINVSANCPNHFEGHYQYKSIPVEDNHKADISSWFNEAIDFIDSIKNAGGRVFVHCQAGISRSATICLAYLMRTNRVKLDEAFEFVKQRRSIISPNFSFMGQLLQFESQVLAPHCSAEAGSPAMAVLDRGTSTTTVFNFPVSIPVHSTNSALSYLQSPITTSPSC

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T35194-Ab Anti-DUSP1 monoclonal antibody
    Target Antigen GM-Tg-g-T35194-Ag DUSP1 protein
    ORF Viral Vector pGMLP005620 Human DUSP1 Lentivirus plasmid
    ORF Viral Vector pGMLV002632 Human DUSP1 Lentivirus plasmid
    ORF Viral Vector pGMPC000141 Human DUSP1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000353 Human DUSP1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC004779 Human DUSP1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP005620 Human DUSP1 Lentivirus particle
    ORF Viral Vector vGMLV002632 Human DUSP1 Lentivirus particle


    Target information

    Target ID GM-T35194
    Target Name DUSP1
    Gene ID 1843, 19252, 702981, 114856, 101093416, 489117, 539175, 100069834
    Gene Symbol and Synonyms 3CH134,CL100,DUSP1,erp,HVH1,MKP-1,MKP1,PTPN10,Ptpn16
    Uniprot Accession P28562
    Uniprot Entry Name DUS1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000120129
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene is a phosphatase with dual specificity for tyrosine and threonine. The encoded protein can dephosphorylate MAP kinase MAPK1/ERK2, which results in its involvement in several cellular processes. This protein appears to play an important role in the human cellular response to environmental stress as well as in the negative regulation of cellular proliferation. Finally, the encoded protein can make some solid tumors resistant to both chemotherapy and radiotherapy, making it a target for cancer therapy. [provided by RefSeq, Aug 2017]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.