Human DUSP1/CL100/HVH1 ORF/cDNA clone-Lentivirus plasmid (NM_004417.3)
Cat. No.: pGMLP005620
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human DUSP1/CL100/HVH1 Lentiviral expression plasmid for DUSP1 lentivirus packaging, DUSP1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
DUSP1/CL100 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP005620 |
Gene Name | DUSP1 |
Accession Number | NM_004417.3 |
Gene ID | 1843 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1104 bp |
Gene Alias | CL100,HVH1,MKP-1,MKP1,PTPN10 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGTCATGGAAGTGGGCACCCTGGACGCTGGAGGCCTGCGGGCGCTGCTGGGGGAGCGAGCGGCGCAATGCCTGCTGCTGGACTGCCGCTCCTTCTTCGCTTTCAACGCCGGCCACATCGCCGGCTCTGTCAACGTGCGCTTCAGCACCATCGTGCGGCGCCGGGCCAAGGGCGCCATGGGCCTGGAGCACATCGTGCCCAACGCCGAGCTCCGCGGCCGCCTGCTGGCCGGCGCCTACCACGCCGTGGTGTTGCTGGACGAGCGCAGCGCCGCCCTGGACGGCGCCAAGCGCGACGGCACCCTGGCCCTGGCGGCCGGCGCGCTCTGCCGCGAGGCGCGCGCCGCGCAAGTCTTCTTCCTCAAAGGAGGATACGAAGCGTTTTCGGCTTCCTGCCCGGAGCTGTGCAGCAAACAGTCGACCCCCATGGGGCTCAGCCTTCCCCTGAGTACTAGCGTCCCTGACAGCGCGGAATCTGGGTGCAGTTCCTGCAGTACCCCACTCTACGATCAGGGTGGCCCGGTGGAAATCCTGCCCTTTCTGTACCTGGGCAGTGCGTATCACGCTTCCCGCAAGGACATGCTGGATGCCTTGGGCATCACTGCCTTGATCAACGTCTCAGCCAATTGTCCCAACCATTTTGAGGGTCACTACCAGTACAAGAGCATCCCTGTGGAGGACAACCACAAGGCAGACATCAGCTCCTGGTTCAACGAGGCCATTGACTTCATAGACTCCATCAAGAATGCTGGAGGAAGGGTGTTTGTCCACTGCCAGGCAGGCATTTCCCGGTCAGCCACCATCTGCCTTGCTTACCTTATGAGGACTAATCGAGTCAAGCTGGACGAGGCCTTTGAGTTTGTGAAGCAGAGGCGAAGCATCATCTCTCCCAACTTCAGCTTCATGGGCCAGCTGCTGCAGTTTGAGTCCCAGGTGCTGGCTCCGCACTGTTCGGCAGAGGCTGGGAGCCCCGCCATGGCTGTGCTCGACCGAGGCACCTCCACCACCACCGTGTTCAACTTCCCCGTCTCCATCCCTGTCCACTCCACGAACAGTGCGCTGAGCTACCTTCAGAGCCCCATTACGACCTCTCCCAGCTGCTGA |
ORF Protein Sequence | MVMEVGTLDAGGLRALLGERAAQCLLLDCRSFFAFNAGHIAGSVNVRFSTIVRRRAKGAMGLEHIVPNAELRGRLLAGAYHAVVLLDERSAALDGAKRDGTLALAAGALCREARAAQVFFLKGGYEAFSASCPELCSKQSTPMGLSLPLSTSVPDSAESGCSSCSTPLYDQGGPVEILPFLYLGSAYHASRKDMLDALGITALINVSANCPNHFEGHYQYKSIPVEDNHKADISSWFNEAIDFIDSIKNAGGRVFVHCQAGISRSATICLAYLMRTNRVKLDEAFEFVKQRRSIISPNFSFMGQLLQFESQVLAPHCSAEAGSPAMAVLDRGTSTTTVFNFPVSIPVHSTNSALSYLQSPITTSPSC |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T35194-Ab | Anti-DUSP1 monoclonal antibody |
Target Antigen | GM-Tg-g-T35194-Ag | DUSP1 protein |
ORF Viral Vector | pGMLP005620 | Human DUSP1 Lentivirus plasmid |
ORF Viral Vector | pGMLV002632 | Human DUSP1 Lentivirus plasmid |
ORF Viral Vector | pGMPC000141 | Human DUSP1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC000353 | Human DUSP1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC004779 | Human DUSP1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLP005620 | Human DUSP1 Lentivirus particle |
ORF Viral Vector | vGMLV002632 | Human DUSP1 Lentivirus particle |
Target information
Target ID | GM-T35194 |
Target Name | DUSP1 |
Gene ID | 1843, 19252, 702981, 114856, 101093416, 489117, 539175, 100069834 |
Gene Symbol and Synonyms | 3CH134,CL100,DUSP1,erp,HVH1,MKP-1,MKP1,PTPN10,Ptpn16 |
Uniprot Accession | P28562 |
Uniprot Entry Name | DUS1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000120129 |
Target Classification | Tumor-associated antigen (TAA) |
The protein encoded by this gene is a phosphatase with dual specificity for tyrosine and threonine. The encoded protein can dephosphorylate MAP kinase MAPK1/ERK2, which results in its involvement in several cellular processes. This protein appears to play an important role in the human cellular response to environmental stress as well as in the negative regulation of cellular proliferation. Finally, the encoded protein can make some solid tumors resistant to both chemotherapy and radiotherapy, making it a target for cancer therapy. [provided by RefSeq, Aug 2017]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.