Human IL34/C16orf77/IL-34 ORF/cDNA clone-Lentivirus plasmid (NM_001172772.1)
Cat. No.: pGMLV000372
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human IL34/C16orf77/IL-34 Lentiviral expression plasmid for IL34 lentivirus packaging, IL34 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
IL34/C16orf77 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMLV000372 |
| Gene Name | IL34 |
| Accession Number | NM_001172772.1 |
| Gene ID | 146433 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 729 bp |
| Gene Alias | C16orf77,IL-34 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGCCCCGGGGCTTCACCTGGCTGCGCTATCTTGGGATCTTCCTTGGCGTGGCCTTGGGGAATGAGCCTTTGGAGATGTGGCCCTTGACGCAGAATGAGGAGTGCACTGTCACGGGTTTTCTGCGGGACAAGCTGCAGTACAGGAGCCGACTTCAGTACATGAAACACTACTTCCCCATCAACTACAAGATCAGTGTGCCTTACGAGGGGGTGTTCAGAATCGCCAACGTCACCAGGCTGCAGAGGGCCCAGGTGAGCGAGCGGGAGCTGCGGTATCTGTGGGTCTTGGTGAGCCTCAGTGCCACTGAGTCGGTGCAGGACGTGCTGCTCGAGGGCCACCCATCCTGGAAGTACCTGCAGGAGGTGGAGACGCTGCTGCTGAATGTCCAGCAGGGCCTCACGGATGTGGAGGTCAGCCCCAAGGTGGAATCCGTGTTGTCCCTCTTGAATGCCCCAGGGCCAAACCTGAAGCTGGTGCGGCCCAAAGCCCTGCTGGACAACTGCTTCCGGGTCATGGAGCTGCTGTACTGCTCCTGCTGTAAACAAAGCTCCGTCCTAAACTGGCAGGACTGTGAGGTGCCAAGTCCTCAGTCTTGCAGCCCAGAGCCCTCATTGCAGTATGCGGCCACCCAGCTGTACCCTCCGCCCCCGTGGTCCCCCAGCTCCCCGCCTCACTCCACGGGCTCGGTGAGGCCGGTCAGGGCACAGGGCGAGGGCCTCTTGCCCTGA |
| ORF Protein Sequence | MPRGFTWLRYLGIFLGVALGNEPLEMWPLTQNEECTVTGFLRDKLQYRSRLQYMKHYFPINYKISVPYEGVFRIANVTRLQRAQVSERELRYLWVLVSLSATESVQDVLLEGHPSWKYLQEVETLLLNVQQGLTDVEVSPKVESVLSLLNAPGPNLKLVRPKALLDNCFRVMELLYCSCCKQSSVLNWQDCEVPSPQSCSPEPSLQYAATQLYPPPPWSPSSPPHSTGSVRPVRAQGEGLLP |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-SE1028-Ab | Anti-IL34/ C16orf77/ IL-34 functional antibody |
| Target Antigen | GM-Tg-g-SE1028-Ag | IL34 protein |
| ORF Viral Vector | pGMLV000372 | Human IL34 Lentivirus plasmid |
| ORF Viral Vector | pGMLP-IL-038 | Human IL34 Lentivirus plasmid |
| ORF Viral Vector | pGMAP-IL-121 | Human IL34 Adenovirus plasmid |
| ORF Viral Vector | pGMPC000680 | Human IL34 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | vGMLV000372 | Human IL34 Lentivirus particle |
| ORF Viral Vector | vGMLP-IL-038 | Human IL34 Lentivirus particle |
| ORF Viral Vector | vGMAP-IL-121 | Human IL34 Adenovirus particle |
Target information
| Target ID | GM-SE1028 |
| Target Name | IL34 |
| Gene ID | 146433, 76527, 709034, 498951, 101094391, 610536, 508292, 100054703 |
| Gene Symbol and Synonyms | 2010004A03Rik,C16orf77,C18H16ORF77,IL-34,IL34 |
| Uniprot Accession | Q6ZMJ4 |
| Uniprot Entry Name | IL34_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000157368 |
| Target Classification | Not Available |
Interleukin-34 is a cytokine that promotes the differentiation and viability of monocytes and macrophages through the colony-stimulating factor-1 receptor (CSF1R; MIM 164770) (Lin et al., 2008 [PubMed 18467591]).[supplied by OMIM, May 2008]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


