Human FOXC2/FKHL14/ LD ORF/cDNA clone-Lentivirus plasmid (NM_005251)

Pre-made Human FOXC2/FKHL14/ LD Lentiviral expression plasmid for FOXC2 lentivirus packaging, FOXC2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to FOXC2/FKHL14 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLV001067 Human FOXC2 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLV001067
Gene Name FOXC2
Accession Number NM_005251
Gene ID 2303
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1506 bp
Gene Alias FKHL14, LD, MFH-1, MFH1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocinmyocin
Fusion Tag Null
Promoter CMV
Resistance Amplicin
Sequence ATGCAGGCGCGCTACTCCGTGTCCGACCCCAACGCCCTGGGAGTGGTGCCCTACCTGAGCGAGCAGAATTACTACCGGGCTGCGGGCAGCTACGGCGGCATGGCCAGCCCCATGGGCGTCTATTCCGGCCACCCGGAGCAGTACAGCGCGGGGATGGGCCGCTCCTACGCGCCCTACCACCACCACCAGCCCGCGGCGCCTAAGGACCTGGTGAAGCCGCCCTACAGCTACATCGCGCTCATCACCATGGCCATCCAGAACGCGCCCGAGAAGAAGATCACCTTGAACGGCATCTACCAGTTCATCATGGACCGCTTCCCCTTCTACCGGGAGAACAAGCAGGGCTGGCAGAACAGCATCCGCCACAACCTCTCGCTCAACGAGTGCTTCGTCAAGGTGCCCCGCGACGACAAGAAGCCCGGCAAGGGCAGTTACTGGACCCTGGACCCGGACTCCTACAACATGTTCGAGAACGGCAGCTTCCTGCGGCGCCGGCGGCGCTTCAAAAAGAAGGACGTGTCCAAGGAGAAGGAGGAGCGGGCCCACCTCAAGGAGCCGCCCCCGGCGGCGTCCAAGGGCGCCCCGGCCACCCCCCACCTAGCGGACGCCCCCAAGGAGGCCGAGAAGAAGGTGGTGATCAAGAGCGAGGCGGCGTCCCCGGCGCTGCCGGTCATCACCAAGGTGGAGACGCTGAGCCCCGAGAGCGCGCTGCAGGGCAGCCCGCGCAGCGCGGCCTCCACGCCCGCCGGCTCCCCCGACGGCTCGCTGCCGGAGCACCACGCCGCGGCGCCCAACGGGCTGCCTGGCTTCAGCGTGGAGAACATCATGACCCTGCGAACGTCGCCGCCGGGCGGAGAGCTGAGCCCGGGGGCCGGACGCGCGGGCCTGGTGGTGCCGCCGCTGGCGCTGCCCTACGCCGCCGCGCCGCCCGCCGCCTACGGCCAGCCGTGCGCTCAGGGCCTGGAGGCCGGGGCCGCCGGGGGCTACCAGTGCAGCATGCGAGCGATGAGCCTGTACACCGGGGCCGAGCGGCCGGCGCACATGTGCGTCCCGCCCGCCCTGGACGAGGCCCTCTCGGACCACCCGAGCGGCCCCACGTCGCCCCTGAGCGCTCTCAACCTCGCCGCCGGCCAGGAGGGCGCGCTCGCCGCCACGGGCCACCACCACCAGCACCACGGCCACCACCACCCGCAGGCGCCGCCGCCCCCGCCGGCTCCCCAGCCCCAGCCGACGCCGCAGCCCGGGGCCGCCGCGGCGCAGGCGGCCTCCTGGTATCTCAACCACAGCGGGGACCTGAACCACCTCCCCGGCCACACGTTCGCGGCCCAGCAGCAAACTTTCCCCAACGTGCGGGAGATGTTCAACTCCCACCGGCTGGGGATTGAGAACTCGACCCTCGGGGAGTCCCAGGTGAGTGGCAATGCCAGCTGCCAGCTGCCCTACAGATCCACGCCGCCTCTCTATCGCCACGCAGCCCCCTACTCCTACGACTGCACGAAATACTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T46092-Ab Anti-FOXC2 monoclonal antibody
    Target Antigen GM-Tg-g-T46092-Ag FOXC2 protein
    ORF Viral Vector pGMLV001067 Human FOXC2 Lentivirus plasmid
    ORF Viral Vector pGMAAV000200 Human FOXC2 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector vGMLV001067 Human FOXC2 Lentivirus particle
    ORF Viral Vector vGMAAV000200 Human FOXC2 Adeno-associate virus(AAV) particle


    Target information

    Target ID GM-T46092
    Target Name FOXC2
    Gene ID 2303, 14234, 694852, 171356, 111558062, 119863920, 507300, 100036555
    Gene Symbol and Synonyms Fkh14,FKHL14,FOXC2,Hfhbf3,LD,LOC119863920,MFH-1,MFH1
    Uniprot Accession Q99958
    Uniprot Entry Name FOXC2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000176692
    Target Classification Tumor-associated antigen (TAA)

    This gene belongs to the forkhead family of transcription factors which is characterized by a distinct DNA-binding forkhead domain.  The specific function of this gene has not yet been determined; however, it may play a role in the development of mesenchymal tissues. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.