Human FOXC2/FKHL14/ LD ORF/cDNA clone-Lentivirus particle (NM_005251)
Pre-made Human FOXC2/FKHL14/ LD Lentiviral expression plasmid for FOXC2 lentivirus packaging, FOXC2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to FOXC2/FKHL14 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLV001067 | Human FOXC2 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLV001067 |
Gene Name | FOXC2 |
Accession Number | NM_005251 |
Gene ID | 2303 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1506 bp |
Gene Alias | FKHL14, LD, MFH-1, MFH1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocinmyocin |
Fusion Tag | Null |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCAGGCGCGCTACTCCGTGTCCGACCCCAACGCCCTGGGAGTGGTGCCCTACCTGAGCGAGCAGAATTACTACCGGGCTGCGGGCAGCTACGGCGGCATGGCCAGCCCCATGGGCGTCTATTCCGGCCACCCGGAGCAGTACAGCGCGGGGATGGGCCGCTCCTACGCGCCCTACCACCACCACCAGCCCGCGGCGCCTAAGGACCTGGTGAAGCCGCCCTACAGCTACATCGCGCTCATCACCATGGCCATCCAGAACGCGCCCGAGAAGAAGATCACCTTGAACGGCATCTACCAGTTCATCATGGACCGCTTCCCCTTCTACCGGGAGAACAAGCAGGGCTGGCAGAACAGCATCCGCCACAACCTCTCGCTCAACGAGTGCTTCGTCAAGGTGCCCCGCGACGACAAGAAGCCCGGCAAGGGCAGTTACTGGACCCTGGACCCGGACTCCTACAACATGTTCGAGAACGGCAGCTTCCTGCGGCGCCGGCGGCGCTTCAAAAAGAAGGACGTGTCCAAGGAGAAGGAGGAGCGGGCCCACCTCAAGGAGCCGCCCCCGGCGGCGTCCAAGGGCGCCCCGGCCACCCCCCACCTAGCGGACGCCCCCAAGGAGGCCGAGAAGAAGGTGGTGATCAAGAGCGAGGCGGCGTCCCCGGCGCTGCCGGTCATCACCAAGGTGGAGACGCTGAGCCCCGAGAGCGCGCTGCAGGGCAGCCCGCGCAGCGCGGCCTCCACGCCCGCCGGCTCCCCCGACGGCTCGCTGCCGGAGCACCACGCCGCGGCGCCCAACGGGCTGCCTGGCTTCAGCGTGGAGAACATCATGACCCTGCGAACGTCGCCGCCGGGCGGAGAGCTGAGCCCGGGGGCCGGACGCGCGGGCCTGGTGGTGCCGCCGCTGGCGCTGCCCTACGCCGCCGCGCCGCCCGCCGCCTACGGCCAGCCGTGCGCTCAGGGCCTGGAGGCCGGGGCCGCCGGGGGCTACCAGTGCAGCATGCGAGCGATGAGCCTGTACACCGGGGCCGAGCGGCCGGCGCACATGTGCGTCCCGCCCGCCCTGGACGAGGCCCTCTCGGACCACCCGAGCGGCCCCACGTCGCCCCTGAGCGCTCTCAACCTCGCCGCCGGCCAGGAGGGCGCGCTCGCCGCCACGGGCCACCACCACCAGCACCACGGCCACCACCACCCGCAGGCGCCGCCGCCCCCGCCGGCTCCCCAGCCCCAGCCGACGCCGCAGCCCGGGGCCGCCGCGGCGCAGGCGGCCTCCTGGTATCTCAACCACAGCGGGGACCTGAACCACCTCCCCGGCCACACGTTCGCGGCCCAGCAGCAAACTTTCCCCAACGTGCGGGAGATGTTCAACTCCCACCGGCTGGGGATTGAGAACTCGACCCTCGGGGAGTCCCAGGTGAGTGGCAATGCCAGCTGCCAGCTGCCCTACAGATCCACGCCGCCTCTCTATCGCCACGCAGCCCCCTACTCCTACGACTGCACGAAATACTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T46092-Ab | Anti-FOXC2 monoclonal antibody |
Target Antigen | GM-Tg-g-T46092-Ag | FOXC2 protein |
ORF Viral Vector | pGMLV001067 | Human FOXC2 Lentivirus plasmid |
ORF Viral Vector | pGMAAV000200 | Human FOXC2 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | vGMLV001067 | Human FOXC2 Lentivirus particle |
ORF Viral Vector | vGMAAV000200 | Human FOXC2 Adeno-associate virus(AAV) particle |
Target information
Target ID | GM-T46092 |
Target Name | FOXC2 |
Gene ID | 2303, 14234, 694852, 171356, 111558062, 119863920, 507300, 100036555 |
Gene Symbol and Synonyms | Fkh14,FKHL14,FOXC2,Hfhbf3,LD,LOC119863920,MFH-1,MFH1 |
Uniprot Accession | Q99958 |
Uniprot Entry Name | FOXC2_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000176692 |
Target Classification | Tumor-associated antigen (TAA) |
This gene belongs to the forkhead family of transcription factors which is characterized by a distinct DNA-binding forkhead domain. The specific function of this gene has not yet been determined; however, it may play a role in the development of mesenchymal tissues. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.