Human XBP1/TREB-5/ TREB5 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_005080.3)

Pre-made Human XBP1/TREB-5/ TREB5 Non-Viral expression plasmid (overexpression vector) for mouse XBP1 overexpression in unique cell transient transfection and stable cell line development.

Target products collectionGo to XBP1/TREB-5 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMPC000167 Human XBP1 Mammalian (Non-Viral Vector) plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMPC000167
Gene Name XBP1
Accession Number NM_005080.3
Gene ID 7494
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 786 bp
Gene Alias TREB-5, TREB5, XBP-1, XBP2
Fluorescent Reporter EGFP
Mammalian Cell Selection
Fusion Tag Null
Promoter CMV
Resistance Amplicin
Sequence ATGGTGGTGGTGGCAGCCGCGCCGAACCCGGCCGACGGGACCCCTAAAGTTCTGCTTCTGTCGGGGCAGCCCGCCTCCGCCGCCGGAGCCCCGGCCGGCCAGGCCCTGCCGCTCATGGTGCCAGCCCAGAGAGGGGCCAGCCCGGAGGCAGCGAGCGGGGGGCTGCCCCAGGCGCGCAAGCGACAGCGCCTCACGCACCTGAGCCCCGAGGAGAAGGCGCTGAGGAGGAAACTGAAAAACAGAGTAGCAGCTCAGACTGCCAGAGATCGAAAGAAGGCTCGAATGAGTGAGCTGGAACAGCAAGTGGTAGATTTAGAAGAAGAGAACCAAAAACTTTTGCTAGAAAATCAGCTTTTACGAGAGAAAACTCATGGCCTTGTAGTTGAGAACCAGGAGTTAAGACAGCGCTTGGGGATGGATGCCCTGGTTGCTGAAGAGGAGGCGGAAGCCAAGGGGAATGAAGTGAGGCCAGTGGCCGGGTCTGCTGAGTCCGCAGCACTCAGACTACGTGCACCTCTGCAGCAGGTGCAGGCCCAGTTGTCACCCCTCCAGAACATCTCCCCATGGATTCTGGCGGTATTGACTCTTCAGATTCAGAGTCTGATATCCTGTTGGGCATTCTGGACAACTTGGACCCAGTCATGTTCTTCAAATGCCCTTCCCCAGAGCCTGCCAGCCTGGAGGAGCTCCCAGAGGTCTACCCAGAAGGACCCAGTTCCTTACCAGCCTCCCTTTCTCTGTCAGTGGGGACGTCATCAGCCAAGCTGGAAGCCATTAATGAACTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2282-Ab Anti-XBP1 monoclonal antibody
    Target Antigen GM-Tg-g-IP2282-Ag XBP1 protein
    ORF Viral Vector pGMLV001207 Human XBP1 Lentivirus plasmid
    ORF Viral Vector pGMAAV000330 Rat Xbp1 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMPC000167 Human XBP1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV001207 Human XBP1 Lentivirus particle
    ORF Viral Vector vGMAAV000330 Rat Xbp1 Adeno-associate virus(AAV) particle
    ORF Viral Vector pGMLV002092 Human XBP1 Lentivirus plasmid
    ORF Viral Vector pGMLV002367 Human XBP1 Lentivirus plasmid


    Target information

    Target ID GM-IP2282
    Target Name XBP1
    Gene ID 7494, 22433, 713863, 289754, 101092150, 477532, 541236, 100059209
    Gene Symbol and Synonyms D11Ertd39e,HTF,TREB-5,TREB5,XBP-1,XBP1,XBP1P1,XBP2,XBPP1
    Uniprot Accession P17861
    Uniprot Entry Name XBP1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Breast Cancer
    Gene Ensembl ENSG00000100219
    Target Classification Pathway

    This gene encodes a transcription factor that regulates MHC class II genes by binding to a promoter element referred to as an X box. This gene product is a bZIP protein, which was also identified as a cellular transcription factor that binds to an enhancer in the promoter of the T cell leukemia virus type 1 promoter. It may increase expression of viral proteins by acting as the DNA binding partner of a viral transactivator. It has been found that upon accumulation of unfolded proteins in the endoplasmic reticulum (ER), the mRNA of this gene is processed to an active form by an unconventional splicing mechanism that is mediated by the endonuclease inositol-requiring enzyme 1 (IRE1). The resulting loss of 26 nt from the spliced mRNA causes a frame-shift and an isoform XBP1(S), which is the functionally active transcription factor. The isoform encoded by the unspliced mRNA, XBP1(U), is constitutively expressed, and thought to function as a negative feedback regulator of XBP1(S), which shuts off transcription of target genes during the recovery phase of ER stress. A pseudogene of XBP1 has been identified and localized to chromosome 5. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.