Human XBP1/TREB-5/ TREB5 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_005080.3)
Pre-made Human XBP1/TREB-5/ TREB5 Non-Viral expression plasmid (overexpression vector) for mouse XBP1 overexpression in unique cell transient transfection and stable cell line development.
Go
to XBP1/TREB-5 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMPC000167 | Human XBP1 Mammalian (Non-Viral Vector) plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMPC000167 |
Gene Name | XBP1 |
Accession Number | NM_005080.3 |
Gene ID | 7494 |
Species | Human |
Product Type | Mammalian (Non-Viral Vector) plasmid (overexpression) |
Insert Length | 786 bp |
Gene Alias | TREB-5, TREB5, XBP-1, XBP2 |
Fluorescent Reporter | EGFP |
Mammalian Cell Selection | |
Fusion Tag | Null |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGTGGTGGTGGCAGCCGCGCCGAACCCGGCCGACGGGACCCCTAAAGTTCTGCTTCTGTCGGGGCAGCCCGCCTCCGCCGCCGGAGCCCCGGCCGGCCAGGCCCTGCCGCTCATGGTGCCAGCCCAGAGAGGGGCCAGCCCGGAGGCAGCGAGCGGGGGGCTGCCCCAGGCGCGCAAGCGACAGCGCCTCACGCACCTGAGCCCCGAGGAGAAGGCGCTGAGGAGGAAACTGAAAAACAGAGTAGCAGCTCAGACTGCCAGAGATCGAAAGAAGGCTCGAATGAGTGAGCTGGAACAGCAAGTGGTAGATTTAGAAGAAGAGAACCAAAAACTTTTGCTAGAAAATCAGCTTTTACGAGAGAAAACTCATGGCCTTGTAGTTGAGAACCAGGAGTTAAGACAGCGCTTGGGGATGGATGCCCTGGTTGCTGAAGAGGAGGCGGAAGCCAAGGGGAATGAAGTGAGGCCAGTGGCCGGGTCTGCTGAGTCCGCAGCACTCAGACTACGTGCACCTCTGCAGCAGGTGCAGGCCCAGTTGTCACCCCTCCAGAACATCTCCCCATGGATTCTGGCGGTATTGACTCTTCAGATTCAGAGTCTGATATCCTGTTGGGCATTCTGGACAACTTGGACCCAGTCATGTTCTTCAAATGCCCTTCCCCAGAGCCTGCCAGCCTGGAGGAGCTCCCAGAGGTCTACCCAGAAGGACCCAGTTCCTTACCAGCCTCCCTTTCTCTGTCAGTGGGGACGTCATCAGCCAAGCTGGAAGCCATTAATGAACTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP2282-Ab | Anti-XBP1 monoclonal antibody |
Target Antigen | GM-Tg-g-IP2282-Ag | XBP1 protein |
ORF Viral Vector | pGMLV001207 | Human XBP1 Lentivirus plasmid |
ORF Viral Vector | pGMAAV000330 | Rat Xbp1 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMPC000167 | Human XBP1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLV001207 | Human XBP1 Lentivirus particle |
ORF Viral Vector | vGMAAV000330 | Rat Xbp1 Adeno-associate virus(AAV) particle |
ORF Viral Vector | pGMLV002092 | Human XBP1 Lentivirus plasmid |
ORF Viral Vector | pGMLV002367 | Human XBP1 Lentivirus plasmid |
Target information
Target ID | GM-IP2282 |
Target Name | XBP1 |
Gene ID | 7494, 22433, 713863, 289754, 101092150, 477532, 541236, 100059209 |
Gene Symbol and Synonyms | D11Ertd39e,HTF,TREB-5,TREB5,XBP-1,XBP1,XBP1P1,XBP2,XBPP1 |
Uniprot Accession | P17861 |
Uniprot Entry Name | XBP1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Not Available |
Disease | Breast Cancer |
Gene Ensembl | ENSG00000100219 |
Target Classification | Pathway |
This gene encodes a transcription factor that regulates MHC class II genes by binding to a promoter element referred to as an X box. This gene product is a bZIP protein, which was also identified as a cellular transcription factor that binds to an enhancer in the promoter of the T cell leukemia virus type 1 promoter. It may increase expression of viral proteins by acting as the DNA binding partner of a viral transactivator. It has been found that upon accumulation of unfolded proteins in the endoplasmic reticulum (ER), the mRNA of this gene is processed to an active form by an unconventional splicing mechanism that is mediated by the endonuclease inositol-requiring enzyme 1 (IRE1). The resulting loss of 26 nt from the spliced mRNA causes a frame-shift and an isoform XBP1(S), which is the functionally active transcription factor. The isoform encoded by the unspliced mRNA, XBP1(U), is constitutively expressed, and thought to function as a negative feedback regulator of XBP1(S), which shuts off transcription of target genes during the recovery phase of ER stress. A pseudogene of XBP1 has been identified and localized to chromosome 5. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.