Human SIRT5/SIR2L5 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_012241)
Pre-made Human SIRT5/SIR2L5 Non-Viral expression plasmid (overexpression vector) for mouse SIRT5 overexpression in unique cell transient transfection and stable cell line development.
Go
to SIRT5/SIR2L5 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMPC000230 | Human SIRT5 Mammalian (Non-Viral Vector) plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMPC000230 |
Gene Name | SIRT5 |
Accession Number | NM_012241 |
Gene ID | 23408 |
Species | Human |
Product Type | Mammalian (Non-Viral Vector) plasmid (overexpression) |
Insert Length | 933 bp |
Gene Alias | SIR2L5 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | HA(C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCGACCTCTCCAGATTGTCCCAAGTCGATTGATTTCCCAGCTATATTGTGGCCTGAAGCCTCCAGCGTCCACACGAAACCAGATTTGCCTGAAAATGGCTCGGCCAAGTTCAAGTATGGCAGATTTTCGAAAGTTTTTTGCAAAAGCAAAGCACATAGTCATCATCTCAGGAGCTGGTGTTAGTGCAGAAAGTGGTGTTCCGACCTTCAGAGGAGCTGGAGGTTATTGGAGAAAATGGCAAGCCCAGGACCTGGCGACTCCCCTGGCCTTTGCCCACAACCCGTCCCGGGTGTGGGAGTTCTACCACTACCGGCGGGAGGTCATGGGGAGCAAGGAGCCCAACGCCGGGCACCGCGCCATAGCCGAGTGTGAGACCCGGCTGGGCAAGCAGGGCCGGCGAGTCGTGGTCATCACCCAGAACATCGATGAGCTGCACCGCAAGGCTGGCACCAAGAACCTTCTGGAGATCCATGGTAGCTTATTTAAAACTCGATGTACCTCTTGTGGAGTTGTGGCTGAGAATTACAAGAGTCCAATTTGTCCAGCTTTATCAGGAAAAGGTGCTCCAGAACCTGGAACTCAAGATGCCAGCATCCCAGTTGAGAAACTTCCCCGGTGTGAAGAGGCAGGCTGCGGGGGCTTGCTGCGACCTCACGTCGTGTGGTTTGGAGAAAACCTGGATCCTGCCATTCTGGAGGAGGTTGACAGAGAGCTCGCCCACTGTGATTTATGTCTAGTGGTGGGCACTTCCTCTGTGGTGTACCCAGCAGCCATGTTTGCCCCCCAGGTGGCTGCCAGGGGCGTGCCAGTGGCTGAATTTAACACGGAGACCACCCCAGCTACGAACAGATTCAGGTTTCATTTCCAGGGACCCTGTGGAACGACTCTTCCTGAAGCCCTTGCCTGTCATGAAAATGAAACTGTTTCTTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Target information
Target ID | GM-T91940 |
Target Name | SIRT5 |
Gene ID | 23408, 68346, 700855, 306840, 101089862, 478726, 507347, 100051757 |
Gene Symbol and Synonyms | 0610012J09Rik,1500032M05Rik,SIR2L5,SIRT5 |
Uniprot Accession | Q9NXA8 |
Uniprot Entry Name | SIR5_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000124523 |
Target Classification | Not Available |
This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined; however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class III of the sirtuin family. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2010]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.