Human RNF130/G1RZFP/GOLIATH ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_018434)

Cat. No.: pGMPC000327
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human RNF130/G1RZFP/GOLIATH Non-Viral expression plasmid (overexpression vector) for mouse RNF130 overexpression in unique cell transient transfection and stable cell line development.


Target products collection

Go to RNF130/G1RZFP products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMPC000327
Gene Name RNF130
Accession Number NM_018434
Gene ID 55819
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 1260 bp
Gene Alias G1RZFP,GOLIATH,GP
Fluorescent Reporter Null
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGCTGCGCGGGGCGGGCGGGCCCTGCCCGGCTCGCCGCGCTCGCCCTGCTGACCTGCAGCCTGTGGCCGGCACGGGCAGACAACGCGAGCCAGGAGTACTACACGGCGCTCATCAACGTGACGGTGCAGGAGCCCGGCCGCGGCGCCCCGCTCACGTTTCGCATCGACCGCGGGCGCTACGGGCTTGACTCCCCCAAGGCCGAGGTCCGCGGCCAGGTGCTGGCGCCGCTGCCCCTCCACGGAGTTGCTGATCATCTGGGCTGTGATCCACAAACCCGGTTCTTTGTCCCTCCTAATATCAAACAGTGGATTGCCTTGCTGCAGAGGGGAAACTGCACGTTTAAAGAGAAAATATCACGGGCCGCTTTCCACAATGCAGTTGCTGTAGTCATCTACAATAATAAATCCAAAGAGGAGCCAGTTACCATGACTCATCCAGGCACTGGAGATATTATTGCTGTCATGATAACAGAATTGAGGGGTAAGGATATTTTGAGTTATCTGGAGAAAAACATCTCTGTACAAATGACAATAGCTGTTGGAACTCGAATGCCACCGAAGAACTTCAGCCGTGGCTCTCTAGTCTTCGTGTCAATATCCTTTATTGTTTTGATGATTATTTCTTCAGCATGGCTCATATTCTACTTCATTCAGAAGATCAGGTACACAAATGCACGCGACAGGAACCAGCGTCGTCTCGGAGATGCAGCCAAGAAAGCCATCAGTAAATTGACAACCAGGACAGTAAAGAAGGGTGACAAGGAAACTGACCCAGACTTTGATCATTGTGCAGTCTGCATAGAGAGCTATAAGCAGAATGATGTCGTCCGAATTCTCCCCTGCAAGCATGTTTTCCACAAATCCTGCGTGGATCCCTGGCTTAGTGAACATTGTACCTGTCCTATGTGCAAACTTAATATATTGAAGGCCCTGGGAATTGTGCCGAATTTGCCATGTACTGATAACGTAGCATTCGATATGGAAAGGCTCACCAGAACCCAAGCTGTTAACCGAAGATCAGCCCTCGGCGACCTCGCCGGCGACAACTCCCTTGGCCTTGAGCCACTTCGAACTTCGGGGATCTCACCTCTTCCTCAGGATGGGGAGCTCACTCCGAGAACAGGAGAAATCAACATTGCAGTAACAAAAGAATGGTTTATTATTGCCAGTTTTGGCCTCCTCAGTGCCCTCACACTCTGCTACATGATCATCAGAGCCACAGCTAGCTTGAATGCTAATGAGGTAGAATGGTTTTGA
ORF Protein Sequence MSCAGRAGPARLAALALLTCSLWPARADNASQEYYTALINVTVQEPGRGAPLTFRIDRGRYGLDSPKAEVRGQVLAPLPLHGVADHLGCDPQTRFFVPPNIKQWIALLQRGNCTFKEKISRAAFHNAVAVVIYNNKSKEEPVTMTHPGTGDIIAVMITELRGKDILSYLEKNISVQMTIAVGTRMPPKNFSRGSLVFVSISFIVLMIISSAWLIFYFIQKIRYTNARDRNQRRLGDAAKKAISKLTTRTVKKGDKETDPDFDHCAVCIESYKQNDVVRILPCKHVFHKSCVDPWLSEHCTCPMCKLNILKALGIVPNLPCTDNVAFDMERLTRTQAVNRRSALGDLAGDNSLGLEPLRTSGISPLPQDGELTPRTGEINIAVTKEWFIIASFGLLSALTLCYMIIRATASLNANEVEWF

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1505-Ab Anti-RNF130 monoclonal antibody
    Target Antigen GM-Tg-g-IP1505-Ag RNF130 protein
    ORF Viral Vector pGMLV002418 Human RNF130 Lentivirus plasmid
    ORF Viral Vector pGMPC000327 Human RNF130 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV002418 Human RNF130 Lentivirus particle


    Target information

    Target ID GM-IP1505
    Target Name RNF130
    Gene ID 55819, 59044, 715356, 652955, 101085174, 474651, 525735, 100067162
    Gene Symbol and Synonyms 2510042A13Rik,G1RP,G1RZFP,GOLIATH,GP,RNF130
    Uniprot Accession Q86XS8
    Uniprot Entry Name GOLI_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000113269
    Target Classification Not Available

    The protein encoded by this gene contains a RING finger motif and is similar to g1, a Drosophila zinc-finger protein that is expressed in mesoderm and involved in embryonic development. The expression of the mouse counterpart was found to be upregulated in myeloblastic cells following IL3 deprivation, suggesting that this gene may regulate growth factor withdrawal-induced apoptosis of myeloid precursor cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.