Human MYC/bHLHe39/ c-Myc ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_002467.5)

Pre-made Human MYC/bHLHe39/ c-Myc Non-Viral expression plasmid (overexpression vector) for mouse MYC overexpression in unique cell transient transfection and stable cell line development.

Target products collectionGo to MYC/bHLHe39 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMPC000377 Human MYC Mammalian (Non-Viral Vector) plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMPC000377
Gene Name MYC
Accession Number NM_002467.5
Gene ID 4609
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 1365 bp
Gene Alias bHLHe39, c-Myc, MRTL, MYCC
Fluorescent Reporter EGFP
Mammalian Cell Selection
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence CTGGATTTTTTTCGGGTAGTGGAAAACCAGCAGCCTCCCGCGACGATGCCCCTCAACGTTAGCTTCACCAACAGGAACTATGACCTCGACTACGACTCGGTGCAGCCGTATTTCTACTGCGACGAGGAGGAGAACTTCTACCAGCAGCAGCAGCAGAGCGAGCTGCAGCCCCCGGCGCCCAGCGAGGATATCTGGAAGAAATTCGAGCTGCTGCCCACCCCGCCCCTGTCCCCTAGCCGCCGCTCCGGGCTCTGCTCGCCCTCCTACGTTGCGGTCACACCCTTCTCCCTTCGGGGAGACAACGACGGCGGTGGCGGGAGCTTCTCCACGGCCGACCAGCTGGAGATGGTGACCGAGCTGCTGGGAGGAGACATGGTGAACCAGAGTTTCATCTGCGACCCGGACGACGAGACCTTCATCAAAAACATCATCATCCAGGACTGTATGTGGAGCGGCTTCTCGGCCGCCGCCAAGCTCGTCTCAGAGAAGCTGGCCTCCTACCAGGCTGCGCGCAAAGACAGCGGCAGCCCGAACCCCGCCCGCGGCCACAGCGTCTGCTCCACCTCCAGCTTGTACCTGCAGGATCTGAGCGCCGCCGCCTCAGAGTGCATCGACCCCTCGGTGGTCTTCCCCTACCCTCTCAACGACAGCAGCTCGCCCAAGTCCTGCGCCTCGCAAGACTCCAGCGCCTTCTCTCCGTCCTCGGATTCTCTGCTCTCCTCGACGGAGTCCTCCCCGCAGGGCAGCCCCGAGCCCCTGGTGCTCCATGAGGAGACACCGCCCACCACCAGCAGCGACTCTGAGGAGGAACAAGAAGATGAGGAAGAAATCGATGTTGTTTCTGTGGAAAAGAGGCAGGCTCCTGGCAAAAGGTCAGAGTCTGGATCACCTTCTGCTGGAGGCCACAGCAAACCTCCTCACAGCCCACTGGTCCTCAAGAGGTGCCACGTCTCCACACATCAGCACAACTACGCAGCGCCTCCCTCCACTCGGAAGGACTATCCTGCTGCCAAGAGGGTCAAGTTGGACAGTGTCAGAGTCCTGAGACAGATCAGCAACAACCGAAAATGCACCAGCCCCAGGTCCTCGGACACCGAGGAGAATGTCAAGAGGCGAACACACAACGTCTTGGAGCGCCAGAGGAGGAACGAGCTAAAACGGAGCTTTTTTGCCCTGCGTGACCAGATCCCGGAGTTGGAAAACAATGAAAAGGCCCCCAAGGTAGTTATCCTTAAAAAAGCCACAGCATACATCCTGTCCGTCCAAGCAGAGGAGCAAAAGCTCATTTCTGAAGAGGACTTGTTGCGGAAACGACGAGAACAGTTGAAACACAAACTTGAACAGCTACGGAACTCTTGTGCGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T36121-Ab Anti-MYC monoclonal antibody
    Target Antigen GM-Tg-g-T36121-Ag MYC protein
    ORF Viral Vector pGMLV000287 Human MYC Lentivirus plasmid
    ORF Viral Vector pGMLV000288 Human MYC Lentivirus plasmid
    ORF Viral Vector pGMLV000614 Human MYC Lentivirus plasmid
    ORF Viral Vector pGMLV002028 Rat Myc Lentivirus plasmid
    ORF Viral Vector pGMAD000252 Rat Myc Adenovirus plasmid
    ORF Viral Vector pGMAD000465 Rat Myc Adenovirus plasmid
    ORF Viral Vector pGMAD000804 Human MYC Adenovirus plasmid
    ORF Viral Vector pGMPC000377 Human MYC Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000706 Rat Myc Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMAP000557 Human MYC Adenovirus plasmid
    ORF Viral Vector vGMLV000287 Human MYC Lentivirus particle
    ORF Viral Vector vGMLV000288 Human MYC Lentivirus particle
    ORF Viral Vector vGMLV000614 Human MYC Lentivirus particle
    ORF Viral Vector vGMLV002028 Rat Myc Lentivirus particle
    ORF Viral Vector vGMAD000252 Rat Myc Adenovirus particle
    ORF Viral Vector vGMAD000465 Rat Myc Adenovirus particle
    ORF Viral Vector vGMAD000804 Human MYC Adenovirus particle
    ORF Viral Vector vGMAP000557 Human MYC Adenovirus particle
    ORF Viral Vector pGMLV002214 Mouse Myc Lentivirus plasmid
    ORF Viral Vector pGMLV002221 Human MYC Lentivirus plasmid
    ORF Viral Vector pGMLV002481 Mouse Myc Lentivirus plasmid


    Target information

    Target ID GM-T36121
    Target Name MYC
    Gene ID 4609, 17869, 694626, 24577, 100379628, 403924, 511077, 100068097
    Gene Symbol and Synonyms bHLHe39,c-Myc,CMYC,mMyc,MRTL,MYC,Myc2,MYCC,Niard,Nird,RNCMYC,v-myc
    Uniprot Accession P01106
    Uniprot Entry Name MYC_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Breast Cancer, Lung Cancer, Lung cancer
    Gene Ensembl ENSG00000136997
    Target Classification Not Available

    This gene is a proto-oncogene and encodes a nuclear phosphoprotein that plays a role in cell cycle progression, apoptosis and cellular transformation. The encoded protein forms a heterodimer with the related transcription factor MAX. This complex binds to the E box DNA consensus sequence and regulates the transcription of specific target genes. Amplification of this gene is frequently observed in numerous human cancers. Translocations involving this gene are associated with Burkitt lymphoma and multiple myeloma in human patients. There is evidence to show that translation initiates both from an upstream, in-frame non-AUG (CUG) and a downstream AUG start site, resulting in the production of two isoforms with distinct N-termini. [provided by RefSeq, Aug 2017]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.