Human EFNB2/EPLG5/Htk-L ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_004093.4)

Cat. No.: pGMPC000583
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human EFNB2/EPLG5/Htk-L Non-Viral expression plasmid (overexpression vector) for mouse EFNB2 overexpression in unique cell transient transfection and stable cell line development.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to EFNB2/EPLG5 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMPC000583
Gene Name EFNB2
Accession Number NM_004093.4
Gene ID 1948
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 1002 bp
Gene Alias EPLG5,Htk-L,HTKL,LERK5
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGGCTGTGAGAAGGGACTCCGTGTGGAAGTACTGCTGGGGTGTTTTGATGGTTTTATGCAGAACTGCGATTTCCAAATCGATAGTTTTAGAGCCTATCTATTGGAATTCCTCGAACTCCAAATTTCTACCTGGACAAGGACTGGTACTATACCCACAGATAGGAGACAAATTGGATATTATTTGCCCCAAAGTGGACTCTAAAACTGTTGGCCAGTATGAATATTATAAAGTTTATATGGTTGATAAAGACCAAGCAGACAGATGCACTATTAAGAAGGAAAATACCCCTCTCCTCAACTGTGCCAAACCAGACCAAGATATCAAATTCACCATCAAGTTTCAAGAATTCAGCCCTAACCTCTGGGGTCTAGAATTTCAGAAGAACAAAGATTATTACATTATATCTACATCAAATGGGTCTTTGGAGGGCCTGGATAACCAGGAGGGAGGGGTGTGCCAGACAAGAGCCATGAAGATCCTCATGAAAGTTGGACAAGATGCAAGTTCTGCTGGATCAACCAGGAATAAAGATCCAACAAGACGTCCAGAACTAGAAGCTGGTACAAATGGAAGAAGTTCGACAACAAGTCCCTTTGTAAAACCAAATCCAGGTTCTAGCACAGACGGCAACAGCGCCGGACATTCGGGGAACAACATCCTCGGTTCCGAAGTGGCCTTATTTGCAGGGATTGCTTCAGGATGCATCATCTTCATCGTCATCATCATCACGCTGGTGGTCCTCTTGCTGAAGTACCGGAGGAGACACAGGAAGCACTCGCCGCAGCACACGACCACGCTGTCGCTCAGCACACTGGCCACACCCAAGCGCAGCGGCAACAACAACGGCTCAGAGCCCAGTGACATTATCATCCCGCTAAGGACTGCGGACAGCGTCTTCTGCCCTCACTACGAGAAGGTCAGCGGGGACTACGGGCACCCGGTGTACATCGTCCAGGAGATGCCCCCGCAGAGCCCGGCGAACATTTACTACAAGGTCTGA
ORF Protein Sequence MAVRRDSVWKYCWGVLMVLCRTAISKSIVLEPIYWNSSNSKFLPGQGLVLYPQIGDKLDIICPKVDSKTVGQYEYYKVYMVDKDQADRCTIKKENTPLLNCAKPDQDIKFTIKFQEFSPNLWGLEFQKNKDYYIISTSNGSLEGLDNQEGGVCQTRAMKILMKVGQDASSAGSTRNKDPTRRPELEAGTNGRSSTTSPFVKPNPGSSTDGNSAGHSGNNILGSEVALFAGIASGCIIFIVIIITLVVLLLKYRRRHRKHSPQHTTTLSLSTLATPKRSGNNNGSEPSDIIIPLRTADSVFCPHYEKVSGDYGHPVYIVQEMPPQSPANIYYKV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0398-Ab Anti-EFNB2/ EPLG5/ HTKL monoclonal antibody
    Target Antigen GM-Tg-g-MP0398-Ag EFNB2 VLP (virus-like particle)
    ORF Viral Vector pGMLV002467 Human EFNB2 Lentivirus plasmid
    ORF Viral Vector pGMPC000583 Human EFNB2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV002467 Human EFNB2 Lentivirus particle


    Target information

    Target ID GM-MP0398
    Target Name EFNB2
    Gene ID 1948, 13642, 711288, 306636, 100135769, 611745, 100139818, 100064730
    Gene Symbol and Synonyms EFNB2,ELF-2,ephrin-B2,Epl5,EPLG5,Htk-L,HTKL,LERK-5,LERK5,NLERK-1
    Uniprot Accession P52799
    Uniprot Entry Name EFNB2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000125266
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a member of the ephrin (EPH) family. The ephrins and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, especially in the nervous system and in erythropoiesis. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. This gene encodes an EFNB class ephrin which binds to the EPHB4 and EPHA3 receptors. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.