Human HAX1/HCLSBP1/HS1BP1 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_006118)

Cat. No.: pGMPC000905
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human HAX1/HCLSBP1/HS1BP1 Non-Viral expression plasmid (overexpression vector) for mouse HAX1 overexpression in unique cell transient transfection and stable cell line development.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to HAX1/HCLSBP1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMPC000905
Gene Name HAX1
Accession Number NM_006118
Gene ID 10456
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 840 bp
Gene Alias HCLSBP1,HS1BP1,SCN3
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGAGCCTCTTTGATCTCTTCCGGGGCTTTTTCGGCTTTCCTGGACCTCGGAGCCACAGAGATCCCTTTTTTGGAGGGATGACTCGAGATGAAGATGATGATGAGGAAGAAGAAGAAGAAGGGGGCTCATGGGGCCGTGGGAACCCAAGGTTCCATAGTCCTCAGCACCCCCCTGAGGAATTTGGCTTCGGCTTCAGCTTCAGCCCAGGAGGAGGGATACGTTTCCACGATAACTTCGGCTTTGATGACCTAGTACGAGATTTCAATAGCATCTTCAGCGATATGGGGGCCTGGACCTTGCCTTCCCATCCTCCTGAACTTCCAGGTCCTGAGTCAGAGACACCTGGTGAGAGACTACGGGAGGGACAGACACTTCGGGACTCAATGCTTAAGTATCCAGATAGTCACCAGCCCAGGATCTTTGGGGGGGTCTTGGAGAGTGATGCAAGAAGTGAATCCCCCCAACCAGCACCAGACTGGGGCTCCCAGAGGCCATTTCATAGGTTTGATGATGTATGGCCTATGGACCCCCATCCTAGAACCAGAGAGGACAATGATCTTGATTCCCAGGTTTCCCAGGAGGGTCTTGGCCCGGTTCTACAGCCCCAGCCCAAATCCTATTTCAAGAGCATCTCTGTGACCAAGATCACTAAACCAGATGGGATAGTGGAGGAGCGCCGGACTGTGGTGGACAGTGAGGGCCGGACAGAGACTACAGTAACCCGACACGAAGCAGATAGCAGTCCTAGGGGTGATCCAGAATCACCAAGACCTCCAGCCCTGGATGATGCCTTTTCCATCCTGGACTTATTCCTGGGACGTTGGTTCCGGTCCCGGTAG
ORF Protein Sequence MSLFDLFRGFFGFPGPRSHRDPFFGGMTRDEDDDEEEEEEGGSWGRGNPRFHSPQHPPEEFGFGFSFSPGGGIRFHDNFGFDDLVRDFNSIFSDMGAWTLPSHPPELPGPESETPGERLREGQTLRDSMLKYPDSHQPRIFGGVLESDARSESPQPAPDWGSQRPFHRFDDVWPMDPHPRTREDNDLDSQVSQEGLGPVLQPQPKSYFKSISVTKITKPDGIVEERRTVVDSEGRTETTVTRHEADSSPRGDPESPRPPALDDAFSILDLFLGRWFRSR

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T20256-Ab Anti-HAX1 monoclonal antibody
    Target Antigen GM-Tg-g-T20256-Ag HAX1 protein
    ORF Viral Vector pGMLP000229 Human HAX1 Lentivirus plasmid
    ORF Viral Vector pGMPC000905 Human HAX1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP000229 Human HAX1 Lentivirus particle


    Target information

    Target ID GM-T20256
    Target Name HAX1
    Gene ID 10456, 23897, 716495, 291202, 101097787, 480134, 506895, 100056899
    Gene Symbol and Synonyms HAX-1,HAX1,HCLSBP1,HS1BP1,HSP1BP-1,mHAX-1s,SCN3,SIG-111,Silg111
    Uniprot Accession O00165
    Uniprot Entry Name HAX1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000143575
    Target Classification Not Available

    The protein encoded by this gene is known to associate with hematopoietic cell-specific Lyn substrate 1, a substrate of Src family tyrosine kinases. It also interacts with the product of the polycystic kidney disease 2 gene, mutations in which are associated with autosomal-dominant polycystic kidney disease, and with the F-actin-binding protein, cortactin. It was earlier thought that this gene product is mainly localized in the mitochondria, however, recent studies indicate it to be localized in the cell body. Mutations in this gene result in autosomal recessive severe congenital neutropenia, also known as Kostmann disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.