Human HAX1/HCLSBP1/HS1BP1 ORF/cDNA clone-Lentivirus particle (NM_006118)
Cat. No.: vGMLP000229
Pre-made Human HAX1/HCLSBP1/HS1BP1 Lentiviral expression plasmid for HAX1 lentivirus packaging, HAX1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
HAX1/HCLSBP1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP000229 | Human HAX1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP000229 |
| Gene Name | HAX1 |
| Accession Number | NM_006118 |
| Gene ID | 10456 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 840 bp |
| Gene Alias | HCLSBP1,HS1BP1,SCN3 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGAGCCTCTTTGATCTCTTCCGGGGCTTTTTCGGCTTTCCTGGACCTCGGAGCCACAGAGATCCCTTTTTTGGAGGGATGACTCGAGATGAAGATGATGATGAGGAAGAAGAAGAAGAAGGGGGCTCATGGGGCCGTGGGAACCCAAGGTTCCATAGTCCTCAGCACCCCCCTGAGGAATTTGGCTTCGGCTTCAGCTTCAGCCCAGGAGGAGGGATACGTTTCCACGATAACTTCGGCTTTGATGACCTAGTACGAGATTTCAATAGCATCTTCAGCGATATGGGGGCCTGGACCTTGCCTTCCCATCCTCCTGAACTTCCAGGTCCTGAGTCAGAGACACCTGGTGAGAGACTACGGGAGGGACAGACACTTCGGGACTCAATGCTTAAGTATCCAGATAGTCACCAGCCCAGGATCTTTGGGGGGGTCTTGGAGAGTGATGCAAGAAGTGAATCCCCCCAACCAGCACCAGACTGGGGCTCCCAGAGGCCATTTCATAGGTTTGATGATGTATGGCCTATGGACCCCCATCCTAGAACCAGAGAGGACAATGATCTTGATTCCCAGGTTTCCCAGGAGGGTCTTGGCCCGGTTCTACAGCCCCAGCCCAAATCCTATTTCAAGAGCATCTCTGTGACCAAGATCACTAAACCAGATGGGATAGTGGAGGAGCGCCGGACTGTGGTGGACAGTGAGGGCCGGACAGAGACTACAGTAACCCGACACGAAGCAGATAGCAGTCCTAGGGGTGATCCAGAATCACCAAGACCTCCAGCCCTGGATGATGCCTTTTCCATCCTGGACTTATTCCTGGGACGTTGGTTCCGGTCCCGGTAG |
| ORF Protein Sequence | MSLFDLFRGFFGFPGPRSHRDPFFGGMTRDEDDDEEEEEEGGSWGRGNPRFHSPQHPPEEFGFGFSFSPGGGIRFHDNFGFDDLVRDFNSIFSDMGAWTLPSHPPELPGPESETPGERLREGQTLRDSMLKYPDSHQPRIFGGVLESDARSESPQPAPDWGSQRPFHRFDDVWPMDPHPRTREDNDLDSQVSQEGLGPVLQPQPKSYFKSISVTKITKPDGIVEERRTVVDSEGRTETTVTRHEADSSPRGDPESPRPPALDDAFSILDLFLGRWFRSR |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T20256-Ab | Anti-HAX1 monoclonal antibody |
| Target Antigen | GM-Tg-g-T20256-Ag | HAX1 protein |
| ORF Viral Vector | pGMLP000229 | Human HAX1 Lentivirus plasmid |
| ORF Viral Vector | pGMPC000905 | Human HAX1 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | vGMLP000229 | Human HAX1 Lentivirus particle |
Target information
| Target ID | GM-T20256 |
| Target Name | HAX1 |
| Gene ID | 10456, 23897, 716495, 291202, 101097787, 480134, 506895, 100056899 |
| Gene Symbol and Synonyms | HAX-1,HAX1,HCLSBP1,HS1BP1,HSP1BP-1,mHAX-1s,SCN3,SIG-111,Silg111 |
| Uniprot Accession | O00165 |
| Uniprot Entry Name | HAX1_HUMAN |
| Protein Sub-location | Introcelluar Protein |
| Category | Therapeutics Target |
| Disease | Not Available |
| Gene Ensembl | ENSG00000143575 |
| Target Classification | Not Available |
The protein encoded by this gene is known to associate with hematopoietic cell-specific Lyn substrate 1, a substrate of Src family tyrosine kinases. It also interacts with the product of the polycystic kidney disease 2 gene, mutations in which are associated with autosomal-dominant polycystic kidney disease, and with the F-actin-binding protein, cortactin. It was earlier thought that this gene product is mainly localized in the mitochondria, however, recent studies indicate it to be localized in the cell body. Mutations in this gene result in autosomal recessive severe congenital neutropenia, also known as Kostmann disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


