Human NFE2L2/HEBP1/IMDDHH ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_006164.5)

Cat. No.: pGMPC000984
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human NFE2L2/HEBP1/IMDDHH Non-Viral expression plasmid (overexpression vector) for mouse NFE2L2 overexpression in unique cell transient transfection and stable cell line development.


Target products collection

Go to Nrf2/NFE2L2/HEBP1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMPC000984
Gene Name NFE2L2
Accession Number NM_006164.5
Gene ID 4780
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 1818 bp
Gene Alias HEBP1,IMDDHH,Nrf-2,NRF2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 6xHis (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGATGGACTTGGAGCTGCCGCCGCCGGGACTCCCGTCCCAGCAGGACATGGATTTGATTGACATACTTTGGAGGCAAGATATAGATCTTGGAGTAAGTCGAGAAGTATTTGACTTCAGTCAGCGACGGAAAGAGTATGAGCTGGAAAAACAGAAAAAACTTGAAAAGGAAAGACAAGAACAACTCCAAAAGGAGCAAGAGAAAGCCTTTTTCGCTCAGTTACAACTAGATGAAGAGACAGGTGAATTTCTCCCAATTCAGCCAGCCCAGCACATCCAGTCAGAAACCAGTGGATCTGCCAACTACTCCCAGGTTGCCCACATTCCCAAATCAGATGCTTTGTACTTTGATGACTGCATGCAGCTTTTGGCGCAGACATTCCCGTTTGTAGATGACAATGAGGTTTCTTCGGCTACGTTTCAGTCACTTGTTCCTGATATTCCCGGTCACATCGAGAGCCCAGTCTTCATTGCTACTAATCAGGCTCAGTCACCTGAAACTTCTGTTGCTCAGGTAGCCCCTGTTGATTTAGACGGTATGCAACAGGACATTGAGCAAGTTTGGGAGGAGCTATTATCCATTCCTGAGTTACAGTGTCTTAATATTGAAAATGACAAGCTGGTTGAGACTACCATGGTTCCAAGTCCAGAAGCCAAACTGACAGAAGTTGACAATTATCATTTTTACTCATCTATACCCTCAATGGAAAAAGAAGTAGGTAACTGTAGTCCACATTTTCTTAATGCTTTTGAGGATTCCTTCAGCAGCATCCTCTCCACAGAAGACCCCAACCAGTTGACAGTGAACTCATTAAATTCAGATGCCACAGTCAACACAGATTTTGGTGATGAATTTTATTCTGCTTTCATAGCTGAGCCCAGTATCAGCAACAGCATGCCCTCACCTGCTACTTTAAGCCATTCACTCTCTGAACTTCTAAATGGGCCCATTGATGTTTCTGATCTATCACTTTGCAAAGCTTTCAACCAAAACCACCCTGAAAGCACAGCAGAATTCAATGATTCTGACTCCGGCATTTCACTAAACACAAGTCCCAGTGTGGCATCACCAGAACACTCAGTGGAATCTTCCAGCTATGGAGACACACTACTTGGCCTCAGTGATTCTGAAGTGGAAGAGCTAGATAGTGCCCCTGGAAGTGTCAAACAGAATGGTCCTAAAACACCAGTACATTCTTCTGGGGATATGGTACAACCCTTGTCACCATCTCAGGGGCAGAGCACTCACGTGCATGATGCCCAATGTGAGAACACACCAGAGAAAGAATTGCCTGTAAGTCCTGGTCATCGGAAAACCCCATTCACAAAAGACAAACATTCAAGCCGCTTGGAGGCTCATCTCACAAGAGATGAACTTAGGGCAAAAGCTCTCCATATCCCATTCCCTGTAGAAAAAATCATTAACCTCCCTGTTGTTGACTTCAACGAAATGATGTCCAAAGAGCAGTTCAATGAAGCTCAACTTGCATTAATTCGGGATATACGTAGGAGGGGTAAGAATAAAGTGGCTGCTCAGAATTGCAGAAAAAGAAAACTGGAAAATATAGTAGAACTAGAGCAAGATTTAGATCATTTGAAAGATGAAAAAGAAAAATTGCTCAAAGAAAAAGGAGAAAATGACAAAAGCCTTCACCTACTGAAAAAACAACTCAGCACCTTATATCTCGAAGTTTTCAGCATGCTACGTGATGAAGATGGAAAACCTTATTCTCCTAGTGAATACTCCCTGCAGCAAACAAGAGATGGCAATGTTTTCCTTGTTCCCAAAAGTAAGAAGCCAGATGTTAAGAAAAACTAG
ORF Protein Sequence MMDLELPPPGLPSQQDMDLIDILWRQDIDLGVSREVFDFSQRRKEYELEKQKKLEKERQEQLQKEQEKAFFAQLQLDEETGEFLPIQPAQHIQSETSGSANYSQVAHIPKSDALYFDDCMQLLAQTFPFVDDNEVSSATFQSLVPDIPGHIESPVFIATNQAQSPETSVAQVAPVDLDGMQQDIEQVWEELLSIPELQCLNIENDKLVETTMVPSPEAKLTEVDNYHFYSSIPSMEKEVGNCSPHFLNAFEDSFSSILSTEDPNQLTVNSLNSDATVNTDFGDEFYSAFIAEPSISNSMPSPATLSHSLSELLNGPIDVSDLSLCKAFNQNHPESTAEFNDSDSGISLNTSPSVASPEHSVESSSYGDTLLGLSDSEVEELDSAPGSVKQNGPKTPVHSSGDMVQPLSPSQGQSTHVHDAQCENTPEKELPVSPGHRKTPFTKDKHSSRLEAHLTRDELRAKALHIPFPVEKIINLPVVDFNEMMSKEQFNEAQLALIRDIRRRGKNKVAAQNCRKRKLENIVELEQDLDHLKDEKEKLLKEKGENDKSLHLLKKQLSTLYLEVFSMLRDEDGKPYSPSEYSLQQTRDGNVFLVPKSKKPDVKKN

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T88505-Ab Anti-NF2L2/ Nrf2/ NFE2L2 monoclonal antibody
    Target Antigen GM-Tg-g-T88505-Ag Nrf2/NFE2L2 VLP (virus-like particle)
    ORF Viral Vector pGMLP005596 Human NFE2L2 Lentivirus plasmid
    ORF Viral Vector pGMLV000194 Human NFE2L2 Lentivirus plasmid
    ORF Viral Vector pGMLV000569 Human nrf2 Lentivirus plasmid
    ORF Viral Vector pGMLV000643 Human NFE2L2 Lentivirus plasmid
    ORF Viral Vector pGMLV000762 Human NFE2L2 Lentivirus plasmid
    ORF Viral Vector pGMLV002215 Human NFE2L2 Lentivirus plasmid
    ORF Viral Vector pGMLV002398 Human NFE2L2 Lentivirus plasmid
    ORF Viral Vector pGMPC000239 Human NFE2L2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000577 Human NFE2L2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000691 Human NFE2L2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000984 Human NFE2L2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC001639 Human NFE2L2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC004843 Human NFE2L2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP005596 Human NFE2L2 Lentivirus particle
    ORF Viral Vector vGMLV000194 Human NFE2L2 Lentivirus particle
    ORF Viral Vector vGMLV000569 Human nrf2 Lentivirus particle
    ORF Viral Vector vGMLV000643 Human NFE2L2 Lentivirus particle
    ORF Viral Vector vGMLV000762 Human NFE2L2 Lentivirus particle
    ORF Viral Vector vGMLV002215 Human NFE2L2 Lentivirus particle
    ORF Viral Vector vGMLV002398 Human NFE2L2 Lentivirus particle


    Target information

    Target ID GM-T88505
    Target Name Nrf2
    Gene ID 4780, 18024, 707606, 83619, 101098812, 478813, 497024, 100066816
    Gene Symbol and Synonyms HEBP1,IMDDHH,NFE2L2,Nrf-2,NRF2
    Uniprot Accession Q16236
    Uniprot Entry Name NF2L2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000116044
    Target Classification Pathway, Tumor-associated antigen (TAA)

    This gene encodes a transcription factor which is a member of a small family of basic leucine zipper (bZIP) proteins. The encoded transcription factor regulates genes which contain antioxidant response elements (ARE) in their promoters; many of these genes encode proteins involved in response to injury and inflammation which includes the production of free radicals. Multiple transcript variants encoding different isoforms have been characterized for this gene. [provided by RefSeq, Sep 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.