Human GNAQ/CMC1/G-ALPHA-q ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_002072.5)

Cat. No.: pGMPC000997
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human GNAQ/CMC1/G-ALPHA-q Non-Viral expression plasmid (overexpression vector) for mouse GNAQ overexpression in unique cell transient transfection and stable cell line development.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to GNAQ/CMC1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMPC000997
Gene Name GNAQ
Accession Number NM_002072.5
Gene ID 2776
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 1080 bp
Gene Alias CMC1,G-ALPHA-q,GAQ,SWS
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGACTCTGGAGTCCATCATGGCGTGCTGCCTGAGCGAGGAGGCCAAGGAAGCCCGGCGGATCAACGACGAGATCGAGCGGCAGCTCCGCAGGGACAAGCGGGACGCCCGCCGGGAGCTCAAGCTGCTGCTGCTCGGGACAGGAGAGAGTGGCAAGAGTACGTTTATCAAGCAGATGAGAATCATCCATGGGTCAGGATACTCTGATGAAGATAAAAGGGGCTTCACCAAGCTGGTGTATCAGAACATCTTCACGGCCATGCAGGCCATGATCAGAGCCATGGACACACTCAAGATCCCATACAAGTATGAGCACAATAAGGCTCATGCACAATTAGTTCGAGAAGTTGATGTGGAGAAGGTGTCTGCTTTTGAGAATCCATATGTAGATGCAATAAAGAGTTTATGGAATGATCCTGGAATCCAGGAATGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTATCTTAATGACTTGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTTAGAGTTCGAGTCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCATTTTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCTTTGAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTGGAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAGGCTCTCTTTAGAACAATTATCACATACCCCTGGTTCCAGAACTCCTCGGTTATTCTGTTCTTAAACAAGAAAGATCTTCTAGAGGAGAAAATCATGTATTCCCATCTAGTCGACTACTTCCCAGAATATGATGGACCCCAGAGAGATGCCCAGGCAGCCCGAGAATTCATTCTGAAGATGTTCGTGGACCTGAACCCAGACAGTGACAAAATTATCTACTCCCACTTCACGTGCGCCACAGACACCGAGAATATCCGCTTTGTCTTTGCTGCCGTCAAGGACACCATCCTCCAGTTGAACCTGAAGGAGTACAATCTGGTCTAA
ORF Protein Sequence MTLESIMACCLSEEAKEARRINDEIERQLRRDKRDARRELKLLLLGTGESGKSTFIKQMRIIHGSGYSDEDKRGFTKLVYQNIFTAMQAMIRAMDTLKIPYKYEHNKAHAQLVREVDVEKVSAFENPYVDAIKSLWNDPGIQECYDRRREYQLSDSTKYYLNDLDRVADPAYLPTQQDVLRVRVPTTGIIEYPFDLQSVIFRMVDVGGQRSERRKWIHCFENVTSIMFLVALSEYDQVLVESDNENRMEESKALFRTIITYPWFQNSSVILFLNKKDLLEEKIMYSHLVDYFPEYDGPQRDAQAAREFILKMFVDLNPDSDKIIYSHFTCATDTENIRFVFAAVKDTILQLNLKEYNLV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T12290-Ab Anti-GNAQ/ CMC1/ G-ALPHA-q monoclonal antibody
    Target Antigen GM-Tg-g-T12290-Ag GNAQ VLP (virus-like particle)
    ORF Viral Vector pGMAP000230 Human GNAQ Adenovirus plasmid
    ORF Viral Vector pGMPC000997 Human GNAQ Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMAP000230 Human GNAQ Adenovirus particle


    Target information

    Target ID GM-T12290
    Target Name GNAQ
    Gene ID 2776, 14682, 81666, 101094708, 403928, 536654, 100063136
    Gene Symbol and Synonyms 1110005L02Rik,6230401I02Rik,CMAL,CMC1,Dsk1,Dsk10,G-ALPHA-q,Galphaq,GAQ,GNAQ,Gq,GqI,SWS
    Uniprot Accession P50148
    Uniprot Entry Name GNAQ_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000156052
    Target Classification Tumor-associated antigen (TAA)

    This locus encodes a guanine nucleotide-binding protein. The encoded protein, an alpha subunit in the Gq class, couples a seven-transmembrane domain receptor to activation of phospolipase C-beta. Mutations at this locus have been associated with problems in platelet activation and aggregation. A related pseudogene exists on chromosome 2.[provided by RefSeq, Nov 2010]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.