Human NGF/Beta-NGF/ HSAN5 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_002506.3)

Pre-made Human NGF/Beta-NGF/ HSAN5 Non-Viral expression plasmid (overexpression vector) for mouse NGF overexpression in unique cell transient transfection and stable cell line development.

Target products collectionGo to NGF/Beta-NGF products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMPC001164 Human NGF Mammalian (Non-Viral Vector) plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMPC001164
Gene Name NGF
Accession Number NM_002506.3
Gene ID 4803
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 726 bp
Gene Alias Beta-NGF, HSAN5, NGFB
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTCCATGTTGTTCTACACTCTGATCACAGCTTTTCTGATCGGCATACAGGCGGAACCACACTCAGAGAGCAATGTCCCTGCAGGACACACCATCCCCCAAGCCCACTGGACTAAACTTCAGCATTCCCTTGACACTGCCCTTCGCAGAGCCCGCAGCGCCCCGGCAGCGGCGATAGCTGCACGCGTGGCGGGGCAGACCCGCAACATTACTGTGGACCCCAGGCTGTTTAAAAAGCGGCGACTCCGTTCACCCCGTGTGCTGTTTAGCACCCAGCCTCCCCGTGAAGCTGCAGACACTCAGGATCTGGACTTCGAGGTCGGTGGTGCTGCCCCCTTCAACAGGACTCACAGGAGCAAGCGGTCATCATCCCATCCCATCTTCCACAGGGGCGAATTCTCGGTGTGTGACAGTGTCAGCGTGTGGGTTGGGGATAAGACCACCGCCACAGACATCAAGGGCAAGGAGGTGATGGTGTTGGGAGAGGTGAACATTAACAACAGTGTATTCAAACAGTACTTTTTTGAGACCAAGTGCCGGGACCCAAATCCCGTTGACAGCGGGTGCCGGGGCATTGACTCAAAGCACTGGAACTCATATTGTACCACGACTCACACCTTTGTCAAGGCGCTGACCATGGATGGCAAGCAGGCTGCCTGGCGGTTTATCCGGATAGATACGGCCTGTGTGTGTGTGCTCAGCAGGAAGGCTGTGAGAAGAGCCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T85670-Ab Anti-NGF/ Beta-NGF/ HSAN5B functional antibody
    Target Antigen GM-Tg-g-T85670-Ag NGF protein
    Cytokine cks-Tg-g-GM-T85670 Nerve growth factor (NGF) protein & antibody
    ORF Viral Vector pGMLV000284 Human NGF Lentivirus plasmid
    ORF Viral Vector pGMLV001031 Rat Ngf Lentivirus plasmid
    ORF Viral Vector pGMAAV000148 Rat Ngf Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV000485 Human NGF Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMPC001164 Human NGF Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000284 Human NGF Lentivirus particle
    ORF Viral Vector vGMLV001031 Rat Ngf Lentivirus particle
    ORF Viral Vector vGMAAV000148 Rat Ngf Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV000485 Human NGF Adeno-associate virus(AAV) particle


    Target information

    Target ID GM-T85670
    Target Name NGF
    Gene ID 4803, 18049, 711681, 310738, 100144611, 403402, 281350, 100065669
    Gene Symbol and Synonyms Beta-NGF,HSAN5,NGF,NGFB
    Uniprot Accession P01138
    Uniprot Entry Name NGF_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease Overactive bladder, Bladder Pain, Interstitial cystitis (chronic), Urinary Tract Infection, Neurological deficits - peripheral neuropathy, Parkinson's Disease
    Gene Ensembl ENSG00000134259
    Target Classification Not Available

    This gene is a member of the NGF-beta family and encodes a secreted protein which homodimerizes and is incorporated into a larger complex. This protein has nerve growth stimulating activity and the complex is involved in the regulation of growth and the differentiation of sympathetic and certain sensory neurons. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy, type 5 (HSAN5), and dysregulation of this gene's expression is associated with allergic rhinitis. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.