Human FBXO3/FBA/FBX3 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_012175.4)

Cat. No.: pGMPC001309
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human FBXO3/FBA/FBX3 Non-Viral expression plasmid (overexpression vector) for mouse FBXO3 overexpression in unique cell transient transfection and stable cell line development.


Target products collection

Go to FBXO3/FBA products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMPC001309
Gene Name FBXO3
Accession Number NM_012175.4
Gene ID 26273
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 1416 bp
Gene Alias FBA,FBX3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGGCCATGGAGACCGAGACGGCGCCGCTGACCCTAGAGTCGCTGCCCACCGATCCCCTGCTCCTCATCTTATCCTTTTTGGACTATCGGGATCTAATCAACTGTTGTTATGTCAGTCGAAGACTTAGCCAGCTATCAAGTCATGATCCGCTGTGGAGAAGACATTGCAAAAAATACTGGCTGATATCTGAGGAAGAGAAAACACAGAAGAATCAGTGTTGGAAATCTCTCTTCATAGATACTTACTCTGATGTAGGAAGATACATTGACCATTATGCTGCTATTAAAAAGGCCTGGGATGATCTCAAGAAATATTTGGAGCCCAGGTGTCCTCGGATGGTTTTATCTCTGAAAGAGGGTGCTCGAGAGGAAGACCTCGATGCTGTGGAAGCGCAGATTGGCTGCAAGCTTCCTGACGATTATCGATGTTCATACCGAATTCACAATGGACAGAAGTTAGTGGTTCCTGGGTTATTGGGAAGCATGGCACTGTCTAATCACTATCGTTCTGAAGATTTGTTAGACGTCGATACAGCTGCCGGAGGATTCCAGCAGAGACAGGGACTGAAATACTGTCTCCCTTTAACTTTTTGCATACATACTGGTTTGAGTCAGTACATAGCAGTGGAAGCTGCAGAGGGCCGAAACAAAAATGAAGTTTTCTACCAATGTCCAGACCAAATGGCTCGAAATCCAGCTGCTATTGACATGTTTATTATAGGTGCTACTTTTACTGACTGGTTTACCTCTTATGTCAAAAATGTTGTATCAGGTGGCTTCCCCATCATCAGAGACCAAATTTTCAGATATGTTCACGATCCAGAATGTGTAGCAACAACTGGGGATATTACTGTGTCAGTTTCCACATCGTTTCTGCCAGAACTTAGCTCTGTACATCCACCCCACTATTTCTTCACATACCGAATCAGGATTGAAATGTCAAAAGATGCACTTCCTGAGAAGGCCTGTCAGTTGGACAGTCGCTATTGGAGAATAACAAATGCTAAGGGTGACGTGGAAGAAGTTCAAGGACCTGGAGTAGTTGGTGAATTTCCAATCATCAGCCCAGGTCGGGTATATGAATACACAAGCTGTACCACATTCTCTACAACATCAGGATACATGGAAGGATATTATACCTTCCATTTTCTTTACTTTAAAGACAAGATCTTTAATGTTGCCATTCCCCGATTCCATATGGCATGTCCAACATTCAGGGTGTCTATAGCCCGATTGGAAATGGGTCCTGATGAATATGAAGAGATGGAAGAAGAGGAGGAGGAGGAAGAGGAGGAAGACGAGGATGATGATTCAGCAGATATGGATGAATCAGATGAAGATGATGAAGAGGAGAGACGGAGGAGAGTCTTTGATGTTCCCATTCGCAGACGCCGCTGCTCACGCCTTTTTTAG
ORF Protein Sequence MAAMETETAPLTLESLPTDPLLLILSFLDYRDLINCCYVSRRLSQLSSHDPLWRRHCKKYWLISEEEKTQKNQCWKSLFIDTYSDVGRYIDHYAAIKKAWDDLKKYLEPRCPRMVLSLKEGAREEDLDAVEAQIGCKLPDDYRCSYRIHNGQKLVVPGLLGSMALSNHYRSEDLLDVDTAAGGFQQRQGLKYCLPLTFCIHTGLSQYIAVEAAEGRNKNEVFYQCPDQMARNPAAIDMFIIGATFTDWFTSYVKNVVSGGFPIIRDQIFRYVHDPECVATTGDITVSVSTSFLPELSSVHPPHYFFTYRIRIEMSKDALPEKACQLDSRYWRITNAKGDVEEVQGPGVVGEFPIISPGRVYEYTSCTTFSTTSGYMEGYYTFHFLYFKDKIFNVAIPRFHMACPTFRVSIARLEMGPDEYEEMEEEEEEEEEEDEDDDSADMDESDEDDEEERRRRVFDVPIRRRRCSRLF

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T75819-Ab Anti-FBXO3 monoclonal antibody
    Target Antigen GM-Tg-g-T75819-Ag FBXO3 protein
    ORF Viral Vector pGMLV001780 Human FBXO3 Lentivirus plasmid
    ORF Viral Vector pGMPC001309 Human FBXO3 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC001523 Human FBXO3 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV001780 Human FBXO3 Lentivirus particle


    Target information

    Target ID GM-T75819
    Target Name FBXO3
    Gene ID 26273, 57443, 693281, 690634, 101092462, 475944, 534287, 100059295
    Gene Symbol and Synonyms 1200002G09Rik,1700026K02Rik,FBA,FBX3,FBXO3
    Uniprot Accession Q9UK99
    Uniprot Entry Name FBX3_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000110429
    Target Classification Not Available

    This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Alternative splicing of this gene generates 2 transcript variants diverging at the 3' end. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.