Human FBXO3/FBA/FBX3 ORF/cDNA clone-Lentivirus plasmid (NM_012175.4)
Cat. No.: pGMLV001780
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human FBXO3/FBA/FBX3 Lentiviral expression plasmid for FBXO3 lentivirus packaging, FBXO3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
FBXO3/FBA products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMLV001780 |
| Gene Name | FBXO3 |
| Accession Number | NM_012175.4 |
| Gene ID | 26273 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 1416 bp |
| Gene Alias | FBA,FBX3 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGCGGCCATGGAGACCGAGACGGCGCCGCTGACCCTAGAGTCGCTGCCCACCGATCCCCTGCTCCTCATCTTATCCTTTTTGGACTATCGGGATCTAATCAACTGTTGTTATGTCAGTCGAAGACTTAGCCAGCTATCAAGTCATGATCCGCTGTGGAGAAGACATTGCAAAAAATACTGGCTGATATCTGAGGAAGAGAAAACACAGAAGAATCAGTGTTGGAAATCTCTCTTCATAGATACTTACTCTGATGTAGGAAGATACATTGACCATTATGCTGCTATTAAAAAGGCCTGGGATGATCTCAAGAAATATTTGGAGCCCAGGTGTCCTCGGATGGTTTTATCTCTGAAAGAGGGTGCTCGAGAGGAAGACCTCGATGCTGTGGAAGCGCAGATTGGCTGCAAGCTTCCTGACGATTATCGATGTTCATACCGAATTCACAATGGACAGAAGTTAGTGGTTCCTGGGTTATTGGGAAGCATGGCACTGTCTAATCACTATCGTTCTGAAGATTTGTTAGACGTCGATACAGCTGCCGGAGGATTCCAGCAGAGACAGGGACTGAAATACTGTCTCCCTTTAACTTTTTGCATACATACTGGTTTGAGTCAGTACATAGCAGTGGAAGCTGCAGAGGGCCGAAACAAAAATGAAGTTTTCTACCAATGTCCAGACCAAATGGCTCGAAATCCAGCTGCTATTGACATGTTTATTATAGGTGCTACTTTTACTGACTGGTTTACCTCTTATGTCAAAAATGTTGTATCAGGTGGCTTCCCCATCATCAGAGACCAAATTTTCAGATATGTTCACGATCCAGAATGTGTAGCAACAACTGGGGATATTACTGTGTCAGTTTCCACATCGTTTCTGCCAGAACTTAGCTCTGTACATCCACCCCACTATTTCTTCACATACCGAATCAGGATTGAAATGTCAAAAGATGCACTTCCTGAGAAGGCCTGTCAGTTGGACAGTCGCTATTGGAGAATAACAAATGCTAAGGGTGACGTGGAAGAAGTTCAAGGACCTGGAGTAGTTGGTGAATTTCCAATCATCAGCCCAGGTCGGGTATATGAATACACAAGCTGTACCACATTCTCTACAACATCAGGATACATGGAAGGATATTATACCTTCCATTTTCTTTACTTTAAAGACAAGATCTTTAATGTTGCCATTCCCCGATTCCATATGGCATGTCCAACATTCAGGGTGTCTATAGCCCGATTGGAAATGGGTCCTGATGAATATGAAGAGATGGAAGAAGAGGAGGAGGAGGAAGAGGAGGAAGACGAGGATGATGATTCAGCAGATATGGATGAATCAGATGAAGATGATGAAGAGGAGAGACGGAGGAGAGTCTTTGATGTTCCCATTCGCAGACGCCGCTGCTCACGCCTTTTTTAG |
| ORF Protein Sequence | MAAMETETAPLTLESLPTDPLLLILSFLDYRDLINCCYVSRRLSQLSSHDPLWRRHCKKYWLISEEEKTQKNQCWKSLFIDTYSDVGRYIDHYAAIKKAWDDLKKYLEPRCPRMVLSLKEGAREEDLDAVEAQIGCKLPDDYRCSYRIHNGQKLVVPGLLGSMALSNHYRSEDLLDVDTAAGGFQQRQGLKYCLPLTFCIHTGLSQYIAVEAAEGRNKNEVFYQCPDQMARNPAAIDMFIIGATFTDWFTSYVKNVVSGGFPIIRDQIFRYVHDPECVATTGDITVSVSTSFLPELSSVHPPHYFFTYRIRIEMSKDALPEKACQLDSRYWRITNAKGDVEEVQGPGVVGEFPIISPGRVYEYTSCTTFSTTSGYMEGYYTFHFLYFKDKIFNVAIPRFHMACPTFRVSIARLEMGPDEYEEMEEEEEEEEEEDEDDDSADMDESDEDDEEERRRRVFDVPIRRRRCSRLF |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T75819-Ab | Anti-FBXO3 monoclonal antibody |
| Target Antigen | GM-Tg-g-T75819-Ag | FBXO3 protein |
| ORF Viral Vector | pGMLV001780 | Human FBXO3 Lentivirus plasmid |
| ORF Viral Vector | pGMPC001309 | Human FBXO3 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | pGMPC001523 | Human FBXO3 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | vGMLV001780 | Human FBXO3 Lentivirus particle |
Target information
| Target ID | GM-T75819 |
| Target Name | FBXO3 |
| Gene ID | 26273, 57443, 693281, 690634, 101092462, 475944, 534287, 100059295 |
| Gene Symbol and Synonyms | 1200002G09Rik,1700026K02Rik,FBA,FBX3,FBXO3 |
| Uniprot Accession | Q9UK99 |
| Uniprot Entry Name | FBX3_HUMAN |
| Protein Sub-location | Introcelluar Protein |
| Category | Therapeutics Target |
| Disease | Not Available |
| Gene Ensembl | ENSG00000110429 |
| Target Classification | Not Available |
This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Alternative splicing of this gene generates 2 transcript variants diverging at the 3' end. [provided by RefSeq, Jul 2008]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


