Human MASP2/MAP-2/MAP19 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_139208.3)

Cat. No.: pGMPC001363
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human MASP2/MAP-2/MAP19 Non-Viral expression plasmid (overexpression vector) for mouse MASP2 overexpression in unique cell transient transfection and stable cell line development.


Target products collection

Go to MASP2/MAP-2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMPC001363
Gene Name MASP2
Accession Number NM_139208.3
Gene ID 10747
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 558 bp
Gene Alias MAP-2,MAP19,MASP-2,MASP1P1,sMAP
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGAGGCTGCTGACCCTCCTGGGCCTTCTGTGTGGCTCGGTGGCCACCCCCTTGGGCCCGAAGTGGCCTGAACCTGTGTTCGGGCGCCTGGCATCCCCCGGCTTTCCAGGGGAGTATGCCAATGACCAGGAGCGGCGCTGGACCCTGACTGCACCCCCCGGCTACCGCCTGCGCCTCTACTTCACCCACTTCGACCTGGAGCTCTCCCACCTCTGCGAGTACGACTTCGTCAAGCTGAGCTCGGGGGCCAAGGTGCTGGCCACGCTGTGCGGGCAGGAGAGCACAGACACGGAGCGGGCCCCTGGCAAGGACACTTTCTACTCGCTGGGCTCCAGCCTGGACATTACCTTCCGCTCCGACTACTCCAACGAGAAGCCGTTCACGGGGTTCGAGGCCTTCTATGCAGCCGAGGACATTGACGAGTGCCAGGTGGCCCCGGGAGAGGCGCCCACCTGCGACCACCACTGCCACAACCACCTGGGCGGTTTCTACTGCTCCTGCCGCGCAGGCTACGTCCTGCACCGTAACAAGCGCACCTGCTCAGAGCAGAGCCTCTAG
ORF Protein Sequence MRLLTLLGLLCGSVATPLGPKWPEPVFGRLASPGFPGEYANDQERRWTLTAPPGYRLRLYFTHFDLELSHLCEYDFVKLSSGAKVLATLCGQESTDTERAPGKDTFYSLGSSLDITFRSDYSNEKPFTGFEAFYAAEDIDECQVAPGEAPTCDHHCHNHLGGFYCSCRAGYVLHRNKRTCSEQSL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-366 Pre-Made Narsoplimab biosimilar, Whole mAb, Anti-MASP2 Antibody: Anti-MAP-2/MAP19/MASP-2/MASP1P1/sMAP therapeutic antibody
    Target Antibody GM-Tg-g-T07448-Ab Anti-MASP2/ MAP19/ MASP-2 functional antibody
    Target Antigen GM-Tg-g-T07448-Ag MASP2 protein
    ORF Viral Vector pGMLP001815 Human MASP2 Lentivirus plasmid
    ORF Viral Vector pGMPC000574 Human MASP2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC001363 Human MASP2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC001388 Human MASP2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP001815 Human MASP2 Lentivirus particle


    Target information

    Target ID GM-T07448
    Target Name MASP2
    Gene ID 10747, 17175, 722714, 64459, 101099568, 487447, 505819, 100056770
    Gene Symbol and Synonyms MAP-2,MAP19,MASP-2,MASP1P1,MASP2,sMAP
    Uniprot Accession O00187
    Uniprot Entry Name MASP2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, INN Index
    Disease Acute appendicitis, Dent disease, Contrast - Induced Nephropathy, Congenital occlusion of ureteropelvic junction, Type 2 diabetes mellitus with diabetic nephropathy
    Gene Ensembl ENSG00000009724
    Target Classification Not Available

    This gene encodes a member of the peptidase S1 family of serine proteases. The encoded preproprotein is proteolytically processed to generate A and B chains that heterodimerize to form the mature protease. This protease cleaves complement components C2 and C4 in order to generate C3 convertase in the lectin pathway of the complement system. The encoded protease also plays a role in the coagulation cascade through cleavage of prothrombin to form thrombin. Myocardial infarction and acute stroke patients exhibit reduced serum concentrations of the encoded protein. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.