Human MASP2/MAP19/MASP-2 ORF/cDNA clone-Lentivirus particle (NM_139208)
Cat. No.: vGMLP001815
Pre-made Human MASP2/MAP19/MASP-2 Lentiviral expression plasmid for MASP2 lentivirus packaging, MASP2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
MASP2/MAP19 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP001815 | Human MASP2 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP001815 |
| Gene Name | MASP2 |
| Accession Number | NM_139208 |
| Gene ID | 10747 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 558 bp |
| Gene Alias | MAP19,MASP-2,MASP1P1,sMAP |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGAGGCTGCTGACCCTCCTGGGCCTTCTGTGTGGCTCGGTGGCCACCCCCTTGGGCCCGAAGTGGCCTGAACCTGTGTTCGGGCGCCTGGCATCCCCCGGCTTTCCAGGGGAGTATGCCAATGACCAGGAGCGGCGCTGGACCCTGACTGCACCCCCCGGCTACCGCCTGCGCCTCTACTTCACCCACTTCGACCTGGAGCTCTCCCACCTCTGCGAGTACGACTTCGTCAAGCTGAGCTCGGGGGCCAAGGTGCTGGCCACGCTGTGCGGGCAGGAGAGCACAGACACGGAGCGGGCCCCTGGCAAGGACACTTTCTACTCGCTGGGCTCCAGCCTGGACATTACCTTCCGCTCCGACTACTCCAACGAGAAGCCGTTCACGGGGTTCGAGGCCTTCTATGCAGCCGAGGACATTGACGAGTGCCAGGTGGCCCCGGGAGAGGCGCCCACCTGCGACCACCACTGCCACAACCACCTGGGCGGTTTCTACTGCTCCTGCCGCGCAGGCTACGTCCTGCACCGTAACAAGCGCACCTGCTCAGAGCAGAGCCTCTAG |
| ORF Protein Sequence | MRLLTLLGLLCGSVATPLGPKWPEPVFGRLASPGFPGEYANDQERRWTLTAPPGYRLRLYFTHFDLELSHLCEYDFVKLSSGAKVLATLCGQESTDTERAPGKDTFYSLGSSLDITFRSDYSNEKPFTGFEAFYAAEDIDECQVAPGEAPTCDHHCHNHLGGFYCSCRAGYVLHRNKRTCSEQSL |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Biosimilar | GMP-Bios-ab-366 | Pre-Made Narsoplimab biosimilar, Whole mAb, Anti-MASP2 Antibody: Anti-MAP-2/MAP19/MASP-2/MASP1P1/sMAP therapeutic antibody |
| Target Antibody | GM-Tg-g-T07448-Ab | Anti-MASP2/ MAP19/ MASP-2 functional antibody |
| Target Antigen | GM-Tg-g-T07448-Ag | MASP2 protein |
| ORF Viral Vector | pGMLP001815 | Human MASP2 Lentivirus plasmid |
| ORF Viral Vector | pGMPC000574 | Human MASP2 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | pGMPC001363 | Human MASP2 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | pGMPC001388 | Human MASP2 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | vGMLP001815 | Human MASP2 Lentivirus particle |
Target information
| Target ID | GM-T07448 |
| Target Name | MASP2 |
| Gene ID | 10747, 17175, 722714, 64459, 101099568, 487447, 505819, 100056770 |
| Gene Symbol and Synonyms | MAP-2,MAP19,MASP-2,MASP1P1,MASP2,sMAP |
| Uniprot Accession | O00187 |
| Uniprot Entry Name | MASP2_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target, INN Index |
| Disease | Acute appendicitis, Dent disease, Contrast - Induced Nephropathy, Congenital occlusion of ureteropelvic junction, Type 2 diabetes mellitus with diabetic nephropathy |
| Gene Ensembl | ENSG00000009724 |
| Target Classification | Not Available |
This gene encodes a member of the peptidase S1 family of serine proteases. The encoded preproprotein is proteolytically processed to generate A and B chains that heterodimerize to form the mature protease. This protease cleaves complement components C2 and C4 in order to generate C3 convertase in the lectin pathway of the complement system. The encoded protease also plays a role in the coagulation cascade through cleavage of prothrombin to form thrombin. Myocardial infarction and acute stroke patients exhibit reduced serum concentrations of the encoded protein. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


