Human VIM ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_003380.5)

Cat. No.: pGMPC001368
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human VIM/ Non-Viral expression plasmid (overexpression vector) for mouse VIM overexpression in unique cell transient transfection and stable cell line development.


Target products collection

Go to VIM/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMPC001368
Gene Name VIM
Accession Number NM_003380.5
Gene ID 7431
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 1401 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCCACCAGGTCCGTGTCCTCGTCCTCCTACCGCAGGATGTTCGGCGGCCCGGGCACCGCGAGCCGGCCGAGCTCCAGCCGGAGCTACGTGACTACGTCCACCCGCACCTACAGCCTGGGCAGCGCGCTGCGCCCCAGCACCAGCCGCAGCCTCTACGCCTCGTCCCCGGGCGGCGTGTATGCCACGCGCTCCTCTGCCGTGCGCCTGCGGAGCAGCGTGCCCGGGGTGCGGCTCCTGCAGGACTCGGTGGACTTCTCGCTGGCCGACGCCATCAACACCGAGTTCAAGAACACCCGCACCAACGAGAAGGTGGAGCTGCAGGAGCTGAATGACCGCTTCGCCAACTACATCGACAAGGTGCGCTTCCTGGAGCAGCAGAATAAGATCCTGCTGGCCGAGCTCGAGCAGCTCAAGGGCCAAGGCAAGTCGCGCCTGGGGGACCTCTACGAGGAGGAGATGCGGGAGCTGCGCCGGCAGGTGGACCAGCTAACCAACGACAAAGCCCGCGTCGAGGTGGAGCGCGACAACCTGGCCGAGGACATCATGCGCCTCCGGGAGAAATTGCAGGAGGAGATGCTTCAGAGAGAGGAAGCCGAAAACACCCTGCAATCTTTCAGACAGGATGTTGACAATGCGTCTCTGGCACGTCTTGACCTTGAACGCAAAGTGGAATCTTTGCAAGAAGAGATTGCCTTTTTGAAGAAACTCCACGAAGAGGAAATCCAGGAGCTGCAGGCTCAGATTCAGGAACAGCATGTCCAAATCGATGTGGATGTTTCCAAGCCTGACCTCACGGCTGCCCTGCGTGACGTACGTCAGCAATATGAAAGTGTGGCTGCCAAGAACCTGCAGGAGGCAGAAGAATGGTACAAATCCAAGTTTGCTGACCTCTCTGAGGCTGCCAACCGGAACAATGACGCCCTGCGCCAGGCAAAGCAGGAGTCCACTGAGTACCGGAGACAGGTGCAGTCCCTCACCTGTGAAGTGGATGCCCTTAAAGGAACCAATGAGTCCCTGGAACGCCAGATGCGTGAAATGGAAGAGAACTTTGCCGTTGAAGCTGCTAACTACCAAGACACTATTGGCCGCCTGCAGGATGAGATTCAGAATATGAAGGAGGAAATGGCTCGTCACCTTCGTGAATACCAAGACCTGCTCAATGTTAAGATGGCCCTTGACATTGAGATTGCCACCTACAGGAAGCTGCTGGAAGGCGAGGAGAGCAGGATTTCTCTGCCTCTTCCAAACTTTTCCTCCCTGAACCTGAGGGAAACTAATCTGGATTCACTCCCTCTGGTTGATACCCACTCAAAAAGGACACTTCTGATTAAGACGGTTGAAACTAGAGATGGACAGGTTATCAACGAAACTTCTCAGCATCACGATGACCTTGAATAA
ORF Protein Sequence MSTRSVSSSSYRRMFGGPGTASRPSSSRSYVTTSTRTYSLGSALRPSTSRSLYASSPGGVYATRSSAVRLRSSVPGVRLLQDSVDFSLADAINTEFKNTRTNEKVELQELNDRFANYIDKVRFLEQQNKILLAELEQLKGQGKSRLGDLYEEEMRELRRQVDQLTNDKARVEVERDNLAEDIMRLREKLQEEMLQREEAENTLQSFRQDVDNASLARLDLERKVESLQEEIAFLKKLHEEEIQELQAQIQEQHVQIDVDVSKPDLTAALRDVRQQYESVAAKNLQEAEEWYKSKFADLSEAANRNNDALRQAKQESTEYRRQVQSLTCEVDALKGTNESLERQMREMEENFAVEAANYQDTIGRLQDEIQNMKEEMARHLREYQDLLNVKMALDIEIATYRKLLEGEESRISLPLPNFSSLNLRETNLDSLPLVDTHSKRTLLIKTVETRDGQVINETSQHHDDLE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-966 Pre-Made Pritumumab Biosimilar, Whole Mab: Anti-Vim/Vimentin therapeutic antibody
    Target Antibody GM-Tg-g-MP1921-Ab Anti-VIME/ VIM monoclonal antibody
    Target Antigen GM-Tg-g-MP1921-Ag VIM VLP (virus-like particle)
    ORF Viral Vector pGMAP000082 Human VIM Adenovirus plasmid
    ORF Viral Vector pGMPC001368 Human VIM Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMAP000082 Human VIM Adenovirus particle


    Target information

    Target ID GM-MP1921
    Target Name VIM
    Gene ID 7431, 22352, 705289, 81818, 101091951, 477991, 280955, 100056088
    Gene Symbol and Synonyms VIM
    Uniprot Accession P08670
    Uniprot Entry Name VIME_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, INN Index
    Disease Cancer
    Gene Ensembl ENSG00000026025
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a type III intermediate filament protein. Intermediate filaments, along with microtubules and actin microfilaments, make up the cytoskeleton. The encoded protein is responsible for maintaining cell shape and integrity of the cytoplasm, and stabilizing cytoskeletal interactions. This protein is involved in neuritogenesis and cholesterol transport and functions as an organizer of a number of other critical proteins involved in cell attachment, migration, and signaling. Bacterial and viral pathogens have been shown to attach to this protein on the host cell surface. Mutations in this gene are associated with congenital cataracts in human patients. [provided by RefSeq, Aug 2017]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.