Human VEGFA/MVCD1/ VEGF ORF/cDNA clone-Adeno-associate virus(AAV) particle (NM_001171626.1)
Pre-made Human VEGFA/MVCD1/ VEGF Adeno-associated virus particle for VEGFA in-vivo study, mechanism of action (MOA) research and VEGFA-associated gene therapy development.
At GM Vector Core (GMVC), we stand at the forefront of custom AAV development and produce distinct grades of AAVs employing state-of-the-art methodologies. Uncover more about our expertise.
Go
to VEGFA/MVCD1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | AAV serotype | AAV Grade | AAV quantity |
vGMAAV000786 | Human VEGFA Adeno-associate virus(AAV) particle | AAV1, AAV2, AAV2 variant (Y444F), AAV2 variant (Y272F, Y444F, Y500F, Y730F), AAV2 variant (Y444F, Y730F, Y500F, Y272F, Y704F, Y252F), AAV2 variant(AAV2.7m8), AAV5, AAV6, AAV8, AAV8-1m, AAV8-2m, AAV8 variant (Y733F, Y447F, Y275), AAV9, AAV-Rh.10, AAV-DJ, AAV-DJ/8, AAV-Retro (Retrograde), AAV9-PHP.B, AAV9-PHP.eB, AAV9-PHP.S, AAV-BR1, AAV-2i8, AAV-SIG, AAV-VEC, AAV4, AAV6.2, AAV6.2FF | Pilot Grade | 1.0E+12VG/ml |
5.0E+12VG/ml | ||||
1E+13VG/ml | ||||
5E+13VG/ml | ||||
1E+14VG/ml | ||||
Research Grade | 1.0E+12VG/ml | |||
5.0E+12VG/ml | ||||
1E+13VG/ml | ||||
5E+13VG/ml | ||||
1E+14VG/ml | ||||
GMP-like Grade | inquiry | |||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAAV000786 |
Gene Name | VEGFA |
Accession Number | NM_001171626.1 |
Gene ID | 7422 |
Species | Human |
Product Type | Adeno-associate virus(AAV) particle (overexpression) |
Insert Length | 576 bp |
Gene Alias | MVCD1, VEGF, VPF |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAACTTTCTGCTGTCTTGGGTGCATTGGAGCCTTGCCTTGCTGCTCTACCTCCACCATGCCAAGTGGTCCCAGGCTGCACCCATGGCAGAAGGAGGAGGGCAGAATCATCACGAAGTGGTGAAGTTCATGGATGTCTATCAGCGCAGCTACTGCCATCCAATCGAGACCCTGGTGGACATCTTCCAGGAGTACCCTGATGAGATCGAGTACATCTTCAAGCCATCCTGTGTGCCCCTGATGCGATGCGGGGGCTGCTGCAATGACGAGGGCCTGGAGTGTGTGCCCACTGAGGAGTCCAACATCACCATGCAGATTATGCGGATCAAACCTCACCAAGGCCAGCACATAGGAGAGATGAGCTTCCTACAGCACAACAAATGTGAATGCAGACCAAAGAAAGATAGAGCAAGACAAGAAAATCCCTGTGGGCCTTGCTCAGAGCGGAGAAAGCATTTGTTTGTACAAGATCCGCAGACGTGTAAATGTTCCTGCAAAAACACAGACTCGCGTTGCAAGGCGAGGCAGCTTGAGTTAAACGAACGTACTTGCAGATGTGACAAGCCGAGGCGGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Target information
Target ID | GM-T20761 |
Target Name | VEGFA |
Gene ID | 7422, 22339, 574209, 83785, 493845, 403802, 281572, 100033839 |
Gene Symbol and Synonyms | eVEGF120,eVEGF164,MVCD1,VEGF,VEGF-A,VEGF111,VEGF164,VEGFA,VPF |
Uniprot Accession | P15692 |
Uniprot Entry Name | VEGFA_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Diagnostics Biomarker, Immuno-oncology Target, INN Index, Cytokine Target |
Disease | Lung Cancer, Malignant neoplasm of prostate, Chronic Kidney Disease, Malignant neoplasm of bladder, Type 2 diabetes mellitus with diabetic nephropathy, Urinary bladder urothelial carcinoma |
Gene Ensembl | ENSG00000112715 |
Target Classification | Checkpoint-Immuno Oncology |
This gene is a member of the PDGF/VEGF growth factor family. It encodes a heparin-binding protein, which exists as a disulfide-linked homodimer. This growth factor induces proliferation and migration of vascular endothelial cells, and is essential for both physiological and pathological angiogenesis. Disruption of this gene in mice resulted in abnormal embryonic blood vessel formation. This gene is upregulated in many known tumors and its expression is correlated with tumor stage and progression. Elevated levels of this protein are found in patients with POEMS syndrome, also known as Crow-Fukase syndrome. Allelic variants of this gene have been associated with microvascular complications of diabetes 1 (MVCD1) and atherosclerosis. Alternatively spliced transcript variants encoding different isoforms have been described. There is also evidence for alternative translation initiation from upstream non-AUG (CUG) codons resulting in additional isoforms. A recent study showed that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is antiangiogenic. Expression of some isoforms derived from the AUG start codon is regulated by a small upstream open reading frame, which is located within an internal ribosome entry site. The levels of VEGF are increased during infection with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), thus promoting inflammation by facilitating recruitment of inflammatory cells, and by increasing the level of angiopoietin II (Ang II), one of two products of the SARS-CoV-2 binding target, angiotensin-converting enzyme 2 (ACE2). In turn, Ang II facilitates the elevation of VEGF, thus forming a vicious cycle in the release of inflammatory cytokines. [provided by RefSeq, Jun 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.