Human SPHK1/SPHK ORF/cDNA clone-Adeno-associate virus(AAV) particle (NM_001142601.2)

Cat. No.: vGMAAV001003

Pre-made Human SPHK1/SPHK Adeno-associated virus particle for SPHK1 in-vivo study, mechanism of action (MOA) research and SPHK1-associated gene therapy development.

At GM Vector Core (GMVC), we stand at the forefront of custom AAV development and produce distinct grades of AAVs employing state-of-the-art methodologies. Uncover more about our expertise.

Target products collection

Go to SPHK1/SPHK products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name AAV serotype AAV Grade AAV quantity
vGMAAV001003 Human SPHK1 Adeno-associate virus(AAV) particle AAV1, AAV2, AAV2 variant (Y444F), AAV2 variant (Y272F, Y444F, Y500F, Y730F), AAV2 variant (Y444F, Y730F, Y500F, Y272F, Y704F, Y252F), AAV2 variant(AAV2.7m8), AAV5, AAV6, AAV8, AAV8-1m, AAV8-2m, AAV8 variant (Y733F, Y447F, Y275), AAV9, AAV-Rh.10, AAV-DJ, AAV-DJ/8, AAV-Retro (Retrograde), AAV9-PHP.B, AAV9-PHP.eB, AAV9-PHP.S, AAV-BR1, AAV-2i8, AAV-SIG, AAV-VEC, AAV4, AAV6.2, AAV6.2FF Pilot Grade 1.0E+12VG/ml
5.0E+12VG/ml
1E+13VG/ml
5E+13VG/ml
1E+14VG/ml
Research Grade 1.0E+12VG/ml
5.0E+12VG/ml
1E+13VG/ml
5E+13VG/ml
1E+14VG/ml
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAAV001003
Gene Name SPHK1
Accession Number NM_001142601.2
Gene ID 8877
Species Human
Product Type Adeno-associate virus(AAV) particle (overexpression)
Insert Length 1155 bp
Gene Alias SPHK
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGATCCAGCGGGCGGCCCCCGGGGCGTGCTCCCGCGGCCCTGCCGCGTGCTGGTGCTGCTGAACCCGCGCGGCGGCAAGGGCAAGGCCTTGCAGCTCTTCCGGAGTCACGTGCAGCCCCTTTTGGCTGAGGCTGAAATCTCCTTCACGCTGATGCTCACTGAGCGGCGGAACCACGCGCGGGAGCTGGTGCGGTCGGAGGAGCTGGGCCGCTGGGACGCTCTGGTGGTCATGTCTGGAGACGGGCTGATGCACGAGGTGGTGAACGGGCTCATGGAGCGGCCTGACTGGGAGACCGCCATCCAGAAGCCCCTGTGTAGCCTCCCAGCAGGCTCTGGCAACGCGCTGGCAGCTTCCTTGAACCATTATGCTGGCTATGAGCAGGTCACCAATGAAGACCTCCTGACCAACTGCACGCTATTGCTGTGCCGCCGGCTGCTGTCACCCATGAACCTGCTGTCTCTGCACACGGCTTCGGGGCTGCGCCTCTTCTCTGTGCTCAGCCTGGCCTGGGGCTTCATTGCTGATGTGGACCTAGAGAGTGAGAAGTATCGGCGTCTGGGGGAGATGCGCTTCACTCTGGGCACCTTCCTGCGTCTGGCAGCCCTGCGCACCTACCGCGGCCGACTGGCCTACCTCCCTGTAGGAAGAGTGGGTTCCAAGACACCTGCCTCCCCCGTTGTGGTCCAGCAGGGCCCGGTAGATGCACACCTTGTGCCACTGGAGGAGCCAGTGCCCTCTCACTGGACAGTGGTGCCCGACGAGGACTTTGTGCTAGTCCTGGCACTGCTGCACTCGCACCTGGGCAGTGAGATGTTTGCTGCACCCATGGGCCGCTGTGCAGCTGGCGTCATGCATCTGTTCTACGTGCGGGCGGGAGTGTCTCGTGCCATGCTGCTGCGCCTCTTCCTGGCCATGGAGAAGGGCAGGCATATGGAGTATGAATGCCCCTACTTGGTATATGTGCCCGTGGTCGCCTTCCGCTTGGAGCCCAAGGATGGGAAAGGTGTGTTTGCAGTGGATGGGGAATTGATGGTTAGCGAGGCCGTGCAGGGCCAGGTGCACCCAAACTACTTCTGGATGGTCAGCGGTTGCGTGGAGCCCCCGCCCAGCTGGAAGCCCCAGCAGATGCCACCGCCAGAAGAGCCCTTATGA
ORF Protein Sequence MDPAGGPRGVLPRPCRVLVLLNPRGGKGKALQLFRSHVQPLLAEAEISFTLMLTERRNHARELVRSEELGRWDALVVMSGDGLMHEVVNGLMERPDWETAIQKPLCSLPAGSGNALAASLNHYAGYEQVTNEDLLTNCTLLLCRRLLSPMNLLSLHTASGLRLFSVLSLAWGFIADVDLESEKYRRLGEMRFTLGTFLRLAALRTYRGRLAYLPVGRVGSKTPASPVVVQQGPVDAHLVPLEEPVPSHWTVVPDEDFVLVLALLHSHLGSEMFAAPMGRCAAGVMHLFYVRAGVSRAMLLRLFLAMEKGRHMEYECPYLVYVPVVAFRLEPKDGKGVFAVDGELMVSEAVQGQVHPNYFWMVSGCVEPPPSWKPQQMPPPEEPL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T86014-Ab Anti-SPHK1/ SPHK monoclonal antibody
    Target Antigen GM-Tg-g-T86014-Ag SPHK1 VLP (virus-like particle)
    ORF Viral Vector pGMLP000419 Human SPHK1 Lentivirus plasmid
    ORF Viral Vector pGMLP005387 Human SPHK1 Lentivirus plasmid
    ORF Viral Vector pGMLV000633 Human SPHK1 Lentivirus plasmid
    ORF Viral Vector pGMLV001065 Human SPHK1 Lentivirus plasmid
    ORF Viral Vector pGMAAV001003 Human SPHK1 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector vGMLP000419 Human SPHK1 Lentivirus particle
    ORF Viral Vector vGMLP005387 Human SPHK1 Lentivirus particle
    ORF Viral Vector vGMLV000633 Human SPHK1 Lentivirus particle
    ORF Viral Vector vGMLV001065 Human SPHK1 Lentivirus particle
    ORF Viral Vector vGMAAV001003 Human SPHK1 Adeno-associate virus(AAV) particle


    Target information

    Target ID GM-T86014
    Target Name SPHK1
    Gene ID 8877, 20698, 710441, 170897, 101084918, 483329, 618605, 100058875
    Gene Symbol and Synonyms 1110006G24Rik,Sk1,SPHK,SPHK1,Spk1
    Uniprot Accession Q9NYA1
    Uniprot Entry Name SPHK1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000176170
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene catalyzes the phosphorylation of sphingosine to form sphingosine-1-phosphate (S1P), a lipid mediator with both intra- and extracellular functions. Intracellularly, S1P regulates proliferation and survival, and extracellularly, it is a ligand for cell surface G protein-coupled receptors. This protein, and its product S1P, play a key role in TNF-alpha signaling and the NF-kappa-B activation pathway important in inflammatory, antiapoptotic, and immune processes. Phosphorylation of this protein alters its catalytic activity and promotes its translocation to the plasma membrane. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2017]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.