- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
Sample Application
- • Animal health test
- • In-vitro diagnostics
- • Food & Feed Safety
- • Environmental Safety
- • New drug discovery
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Human CLU/AAG4/ APO-J ORF/cDNA clone-Adenovirus particle (NM_001831.3)
Pre-made Human CLU/AAG4/ APO-J Adenovirus for CLU overexpression in-vitro and in-vivo. The CLU adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified CLU-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to CLU/AAG4 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAD000637 | Human CLU Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAD000637 |
| Gene Name | CLU |
| Accession Number | NM_001831.3 |
| Gene ID | 1191 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 1350 bp |
| Gene Alias | AAG4, APO-J, APOJ, CLI, CLU1, CLU2, KUB1, NA1/NA2, SGP-2, SGP2, SP-40, TRPM-2, TRPM2 |
| Fluorescent Reporter | |
| Mammalian Cell Selection | Null |
| Fusion Tag | Null |
| Promoter | CMV |
| Resistance | Amplicin |
| Sequence | ATGATGAAGACTCTGCTGCTGTTTGTGGGGCTGCTGCTGACCTGGGAGAGTGGGCAGGTCCTGGGGGACCAGACGGTCTCAGACAATGAGCTCCAGGAAATGTCCAATCAGGGAAGTAAGTACGTCAATAAGGAAATTCAAAATGCTGTCAACGGGGTGAAACAGATAAAGACTCTCATAGAAAAAACAAACGAAGAGCGCAAGACACTGCTCAGCAACCTAGAAGAAGCCAAGAAGAAGAAAGAGGATGCCCTAAATGAGACCAGGGAATCAGAGACAAAGCTGAAGGAGCTCCCAGGAGTGTGCAATGAGACCATGATGGCCCTCTGGGAAGAGTGTAAGCCCTGCCTGAAACAGACCTGCATGAAGTTCTACGCACGCGTCTGCAGAAGTGGCTCAGGCCTGGTTGGCCGCCAGCTTGAGGAGTTCCTGAACCAGAGCTCGCCCTTCTACTTCTGGATGAATGGTGACCGCATCGACTCCCTGCTGGAGAACGACCGGCAGCAGACGCACATGCTGGATGTCATGCAGGACCACTTCAGCCGCGCGTCCAGCATCATAGACGAGCTCTTCCAGGACAGGTTCTTCACCCGGGAGCCCCAGGATACCTACCACTACCTGCCCTTCAGCCTGCCCCACCGGAGGCCTCACTTCTTCTTTCCCAAGTCCCGCATCGTCCGCAGCTTGATGCCCTTCTCTCCGTACGAGCCCCTGAACTTCCACGCCATGTTCCAGCCCTTCCTTGAGATGATACACGAGGCTCAGCAGGCCATGGACATCCACTTCCATAGCCCGGCCTTCCAGCACCCGCCAACAGAATTCATACGAGAAGGCGACGATGACCGGACTGTGTGCCGGGAGATCCGCCACAACTCCACGGGCTGCCTGCGGATGAAGGACCAGTGTGACAAGTGCCGGGAGATCTTGTCTGTGGACTGTTCCACCAACAACCCCTCCCAGGCTAAGCTGCGGCGGGAGCTCGACGAATCCCTCCAGGTCGCTGAGAGGTTGACCAGGAAATACAACGAGCTGCTAAAGTCCTACCAGTGGAAGATGCTCAACACCTCCTCCTTGCTGGAGCAGCTGAACGAGCAGTTTAACTGGGTGTCCCGGCTGGCAAACCTCACGCAAGGCGAAGACCAGTACTATCTGCGGGTCACCACGGTGGCTTCCCACACTTCTGACTCGGACGTTCCTTCCGGTGTCACTGAGGTGGTCGTGAAGCTCTTTGACTCTGATCCCATCACTGTGACGGTCCCTGTAGAAGTCTCCAGGAAGAACCCTAAATTTATGGAGACCGTGGCGGAGAAAGCGCTGCAGGAATACCGCAAAAAGCACCGGGAGGAGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Biosimilar | GMP-Bios-ab-696 | Pre-Made Sotevtamab biosimilar, Whole mAb, Anti-CLU/Clusterinm Antibody: Anti-AAG4/APO-J/APOJ/CLI/KUB1/NA1/NA2/SGP-2/SGP2/SP-40/TRPM-2/TRPM2 therapeutic antibody |
| Target Antibody | GM-Tg-g-T96669-Ab | Anti-CLUS/ CLU/ AAG4 functional antibody |
| Target Antigen | GM-Tg-g-T96669-Ag | CLU protein |
| ORF Viral Vector | pGMLV000313 | Human CLU Lentivirus plasmid |
| ORF Viral Vector | pGMAD000502 | Human CLU Adenovirus plasmid |
| ORF Viral Vector | pGMAD000637 | Human CLU Adenovirus plasmid |
| ORF Viral Vector | pGMAAV000344 | Rat Clu Adeno-associate virus(AAV) plasmid |
| ORF Viral Vector | vGMLV000313 | Human CLU Lentivirus particle |
| ORF Viral Vector | vGMAD000502 | Human CLU Adenovirus particle |
| ORF Viral Vector | vGMAD000637 | Human CLU Adenovirus particle |
| ORF Viral Vector | vGMAAV000344 | Rat Clu Adeno-associate virus(AAV) particle |
Target information
| Target ID | GM-T96669 |
| Target Name | CLU |
| Gene ID | 1191, 12759, 677866, 24854, 101092846, 442971, 280750, 100034172 |
| Gene Symbol and Synonyms | AAG4,APO-J,APOJ,CLI,CLU,CLU1,CLU2,D14Ucla3,DAG,GP80,gpIII,KUB1,NA1/NA2,RATTRPM2B,SGP-2,SGP2,SP-40,SP40,Sugp-2,TRPM-2,TRPM2,TRPM2B,Trpmb |
| Uniprot Accession | P10909 |
| Uniprot Entry Name | CLUS_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target, INN Index |
| Disease | leukemia patients, Acute kidney failure, Dent disease, Type 2 diabetes mellitus |
| Gene Ensembl | ENSG00000120885 |
| Target Classification | Not Available |
The protein encoded by this gene is a secreted chaperone that can under some stress conditions also be found in the cell cytosol. It has been suggested to be involved in several basic biological events such as cell death, tumor progression, and neurodegenerative disorders. Alternate splicing results in both coding and non-coding variants.[provided by RefSeq, May 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
Facebook
LinkedIn
Twitter
