Human KCNJ2/ATFB9/ HHBIRK1 ORF/cDNA clone-Adenovirus particle (NM_000891)
Pre-made Human KCNJ2/ATFB9/ HHBIRK1 Adenovirus for KCNJ2 overexpression in-vitro and in-vivo. The KCNJ2 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified KCNJ2-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to KCNJ2/ATFB9 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAD000836 | Human KCNJ2 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAD000836 |
Gene Name | KCNJ2 |
Accession Number | NM_000891 |
Gene ID | 3759 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 1284 bp |
Gene Alias | ATFB9, HHBIRK1, HHIRK1, IRK1, KIR2.1, LQT7, SQT3 |
Fluorescent Reporter | |
Mammalian Cell Selection | Null |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGCAGTGTGCGAACCAACCGCTACAGCATCGTCTCTTCAGAAGAAGACGGTATGAAGTTGGCCACCATGGCAGTTGCAAATGGCTTTGGGAACGGGAAGAGTAAAGTCCACACCCGACAACAGTGCAGGAGCCGCTTTGTGAAGAAAGATGGCCACTGTAATGTTCAGTTCATCAATGTGGGTGAGAAGGGGCAACGGTACCTCGCAGACATCTTCACCACGTGTGTGGACATTCGCTGGCGGTGGATGCTGGTTATCTTCTGCCTGGCTTTCGTCCTGTCATGGCTGTTTTTTGGCTGTGTGTTTTGGTTGATAGCTCTGCTCCATGGGGACCTGGATGCATCCAAAGAGGGCAAAGCTTGTGTGTCCGAGGTCAACAGCTTCACGGCTGCCTTCCTCTTCTCCATTGAGACCCAGACAACCATAGGCTATGGTTTCAGATGTGTCACGGATGAATGCCCAATTGCTGTTTTCATGGTGGTGTTCCAGTCAATCGTGGGCTGCATCATCGATGCTTTCATCATTGGCGCAGTCATGGCCAAGATGGCAAAGCCAAAGAAGAGAAACGAGACTCTTGTCTTCAGTCACAATGCCGTGATTGCCATGAGAGACGGCAAGCTGTGTTTGATGTGGCGAGTGGGCAATCTTCGGAAAAGCCACTTGGTGGAAGCTCATGTTCGAGCACAGCTCCTCAAATCCAGAATTACTTCTGAAGGGGAGTATATCCCTCTGGATCAAATAGACATCAATGTTGGGTTTGACAGTGGAATCGATCGTATATTTCTGGTGTCCCCAATCACTATAGTCCATGAAATAGATGAAGACAGTCCTTTATATGATTTGAGTAAACAGGACATTGACAACGCAGACTTTGAAATCGTGGTCATACTGGAAGGCATGGTGGAAGCCACTGCCATGACGACACAGTGCCGTAGCTCTTATCTAGCAAATGAAATCCTGTGGGGCCACCGCTATGAGCCTGTGCTCTTTGAAGAGAAGCACTACTACAAAGTGGACTATTCCAGGTTCCACAAAACTTACGAAGTCCCCAACACTCCCCTTTGTAGTGCCAGAGACTTAGCAGAAAAGAAATATATCCTCTCAAATGCAAATTCATTTTGCTATGAAAATGAAGTTGCCCTCACAAGCAAAGAGGAAGACGACAGTGAAAATGGAGTTCCAGAAAGCACTAGTACGGACACGCCCCCTGACATAGACCTTCACAACCAGGCAAGTGTACCTCTAGAGCCCAGGCCCTTACGGCGAGAGTCGGAGATATGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T74570-Ab | Anti-KCNJ2/ ATFB9/ HHBIRK1 monoclonal antibody |
Target Antigen | GM-Tg-g-T74570-Ag | KCNJ2 VLP (virus-like particle) |
ORF Viral Vector | pGMLV000106 | Rat Kcnj2 Lentivirus plasmid |
ORF Viral Vector | pGMLV000603 | Rat Kcnj2 Lentivirus plasmid |
ORF Viral Vector | pGMAD000757 | Human KCNJ2 Adenovirus plasmid |
ORF Viral Vector | pGMAD000836 | Human KCNJ2 Adenovirus plasmid |
ORF Viral Vector | pGMLP003142 | Human KCNJ2 Lentivirus plasmid |
ORF Viral Vector | vGMLV000106 | Rat Kcnj2 Lentivirus particle |
ORF Viral Vector | vGMLV000603 | Rat Kcnj2 Lentivirus particle |
ORF Viral Vector | vGMAD000757 | Human KCNJ2 Adenovirus particle |
ORF Viral Vector | vGMAD000836 | Human KCNJ2 Adenovirus particle |
ORF Viral Vector | vGMLP003142 | Human KCNJ2 Lentivirus particle |
Target information
Target ID | GM-T74570 |
Target Name | KCNJ2 |
Gene ID | 3759, 16518, 574189, 29712, 101090306, 403717, 281883, 100052953 |
Gene Symbol and Synonyms | ATFB9,HHBIRK1,HHIRK1,IRK1,Kcnf1,KCNJ2,KIR2.1,LQT7,SQT3 |
Uniprot Accession | P63252 |
Uniprot Entry Name | KCNJ2_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000123700 |
Target Classification | Ion Channel |
Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, probably participates in establishing action potential waveform and excitability of neuronal and muscle tissues. Mutations in this gene have been associated with Andersen syndrome, which is characterized by periodic paralysis, cardiac arrhythmias, and dysmorphic features. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.