Human CSNK2A1/CK2A1/CKII ORF/cDNA clone-Adenovirus particle (BC011668)
                                                               Cat. No.: vGMAP-SPh-148
 
                                                               
                                                               
                                                                
                                                                
                                                                 
                                                                
                                                            
Pre-made Human CSNK2A1/CK2A1/CKII Adenovirus for CSNK2A1 overexpression in-vitro and in-vivo. The CSNK2A1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified CSNK2A1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
                                                                            CSNK2A1/CK2A1 products
                                                                            collection>>
(antibodies,
                                                                            antigen, VLP, mRNA, ORF viral vector, etc)
                                                                        
                                                                    
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity | 
| vGMAP-SPh-148 | Human CSNK2A1 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) | 
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry | 
Product Description
| Catalog ID | vGMAP-SPh-148 | 
| Gene Name | CSNK2A1 | 
| Accession Number | BC011668 | 
| Gene ID | 1457 | 
| Species | Human | 
| Product Type | Adenovirus particle (overexpression) | 
| Insert Length | 1176 bp | 
| Gene Alias | CK2A1,CKII,CKII alpha | 
| Fluorescent Reporter | EGFP | 
| Mammalian Cell Selection | Null | 
| Fusion Tag | 3xflag (C-Terminal) | 
| Promoter | EF1 | 
| Resistance | Amplicin | 
| ORF Nucleotide Sequence | ATGTCGGGACCCGTGCCAAGCAGGGCCAGAGTTTACACAGATGTTAATACACACAGACCTCGAGAATACTGGGATTACGAGTCACATGTGGTGGAATGGGGAAATCAAGATGACTACCAGCTGGTTCGAAAATTAGGCCGAGGTAAATACAGTGAAGTATTTGAAGCCATCAACATCACAAATAATGAAAAAGTTGTTGTTAAAATTCTCAAGCCAGTAAAAAAGAAGAAAATTAAGCGTGAAATAAAGATTTTGGAGAATTTGAGAGGAGGTCCCAACATCATCACACTGGCAGACATTGTAAAAGACCCTGTGTCACGAACCCCCGCCTTGGTTTTTGAACACGTAAACAACACAGACTTCAAGCAATTGTACCAGACGTTAACAGACTATGATATTCGATTTTACATGTATGAGATTCTGAAGGCCCTGGATTATTGTCACAGCATGGGAATTATGCACAGAGATGTCAAGCCCCATAATGTCATGATTGATCATGAGCACAGAAAGCTACGACTAATAGACTGGGGTTTGGCTGAGTTTTATCATCCTGGCCAAGAATATAATGTCCGAGTTGCTTCCCGATACTTCAAAGGTCCTGAGCTACTTGTAGACTATCAGATGTACGATTATAGTTTGGATATGTGGAGTTTGGGTTGTATGCTGGCAAGTATGATCTTTCGGAAGGAGCCATTTTTCCATGGACATGACAATTATGATCAGTTGGTGAGGATAGCCAAGGTTCTGGGGACAGAAGATTTATATGACTATATTGACAAATACAACATTGAATTAGATCCACGTTTCAATGATATCTTGGGCAGACACTCTCGAAAGCGATGGGAACGCTTTGTCCACAGTGAAAATCAGCACCTTGTCAGCCCTGAGGCCTTGGATTTCCTGGACAAACTGCTGCGATATGACCACCAGTCACGGCTTACTGCAAGAGAGGCAATGGAGCACCCCTATTTCTACACTGTTGTGAAGGACCAGGCTCGAATGGGTTCATCTAGCATGCCAGGGGGCAGTACGCCCGTCAGCAGCGCCAATATGATGTCAGGGATTTCTTCAGTGCCAACCCCTTCACCCCTTGGACCTCTGGCAGGCTCACCAGTGATTGCTGCTGCCAACCCCCTTGGGATGCCTGTTCCAGCTGCCGCTGGCGCTCAGCAGTAA | 
| ORF Protein Sequence | MSGPVPSRARVYTDVNTHRPREYWDYESHVVEWGNQDDYQLVRKLGRGKYSEVFEAINITNNEKVVVKILKPVKKKKIKREIKILENLRGGPNIITLADIVKDPVSRTPALVFEHVNNTDFKQLYQTLTDYDIRFYMYEILKALDYCHSMGIMHRDVKPHNVMIDHEHRKLRLIDWGLAEFYHPGQEYNVRVASRYFKGPELLVDYQMYDYSLDMWSLGCMLASMIFRKEPFFHGHDNYDQLVRIAKVLGTEDLYDYIDKYNIELDPRFNDILGRHSRKRWERFVHSENQHLVSPEALDFLDKLLRYDHQSRLTAREAMEHPYFYTVVKDQARMGSSSMPGGSTPVSSANMMSGISSVPTPSPLGPLAGSPVIAAANPLGMPVPAAAGAQQ | 
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name | 
|---|---|---|
| Target Antibody | GM-Tg-g-T51565-Ab | Anti-CSNK2A1 monoclonal antibody | 
| Target Antigen | GM-Tg-g-T51565-Ag | CSNK2A1 protein | 
| ORF Viral Vector | pGMLP005296 | Human CSNK2A1 Lentivirus plasmid | 
| ORF Viral Vector | pGMAP000354 | Human CSNK2A1 Adenovirus plasmid | 
| ORF Viral Vector | pGMLP-SPh-008 | Human CSNK2A1 Lentivirus plasmid | 
| ORF Viral Vector | pGMAP-SPh-148 | Human CSNK2A1 Adenovirus plasmid | 
| ORF Viral Vector | vGMLP005296 | Human CSNK2A1 Lentivirus particle | 
| ORF Viral Vector | vGMAP000354 | Human CSNK2A1 Adenovirus particle | 
| ORF Viral Vector | vGMLP-SPh-008 | Human CSNK2A1 Lentivirus particle | 
| ORF Viral Vector | vGMAP-SPh-148 | Human CSNK2A1 Adenovirus particle | 
Target information
| Target ID | GM-T51565 | 
| Target Name | CSNK2A1 | 
| Gene ID | 1457, 12995, 714841, 116549, 101084186, 477185, 282419, 100067965 | 
| Gene Symbol and Synonyms | CK II alpha,CK2,CK2A1,Cka1,Cka2,CKII,CSNK2A1,Csnk2a1-rs4,OCNDS | 
| Uniprot Accession | P68400 | 
| Uniprot Entry Name | CSK21_HUMAN | 
| Protein Sub-location | Introcelluar Protein | 
| Category | Therapeutics Target | 
| Disease | Prostate Cancer | 
| Gene Ensembl | ENSG00000101266 | 
| Target Classification | Kinase | 
Casein kinase II is a serine/threonine protein kinase that phosphorylates acidic proteins such as casein. It is involved in various cellular processes, including cell cycle control, apoptosis, and circadian rhythm. The kinase exists as a tetramer and is composed of an alpha, an alpha-prime, and two beta subunits. The alpha subunits contain the catalytic activity while the beta subunits undergo autophosphorylation. The protein encoded by this gene represents the alpha subunit. Multiple transcript variants encoding different protein isoforms have been found for this gene. [provided by RefSeq, Apr 2018]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
                
                
            
        
        
                                                            

