Human MAP3K7/TGF1a ORF/cDNA clone-Adenovirus particle (BC017715)

Pre-made Human MAP3K7/TGF1a Adenovirus for MAP3K7 overexpression in-vitro and in-vivo. The MAP3K7 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified MAP3K7-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to MAP3K7/TGF1a products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000498 Human MAP3K7 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000498
Gene Name MAP3K7
Accession Number BC017715
Gene ID 6885
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1740 bp
Gene Alias TGF1a
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTCTACAGCCTCTGCCGCCTCCTCCTCCTCCTCGTCTTCGGCCGGTGAGATGATCGAAGCCCCTTCCCAGGTCCTCAACTTTGAAGAGATCGACTACAAGGAGATCGAGGTGGAAGAGGTTGTTGGAAGAGGAGCCTTTGGAGTTGTTTGCAAAGCTAAGTGGAGAGCAAAAGATGTTGCTATTAAACAAATAGAAAGTGAATCTGAGAGGAAAGCGTTTATTGTAGAGCTTCGGCAGTTATCCCGTGTGAACCATCCTAATATTGTAAAGCTTTATGGAGCCTGCTTGAATCCAGTGTGTCTTGTGATGGAATATGCTGAAGGGGGCTCTTTATATAATGTGCTGCATGGTGCTGAACCATTGCCATATTATACTGCTGCCCACGCAATGAGTTGGTGTTTACAGTGTTCCCAAGGAGTGGCTTATCTTCACAGCATGCAACCCAAAGCGCTAATTCACAGGGACCTGAAACCACCAAACTTACTGCTGGTTGCAGGGGGGACAGTTCTAAAAATTTGTGATTTTGGTACAGCCTGTGACATTCAGACACACATGACCAATAACAAGGGGAGTGCTGCTTGGATGGCACCTGAAGTTTTTGAAGGTAGTAATTACAGTGAAAAATGTGACGTCTTCAGCTGGGGTATTATTCTTTGGGAAGTGATAACGCGTCGGAAACCCTTTGATGAGATTGGTGGCCCAGCTTTCCGAATCATGTGGGCTGTTCATAATGGTACTCGACCACCACTGATAAAAAATTTACCTAAGCCCATTGAGAGCCTGATGACTCGTTGTTGGTCTAAAGATCCTTCCCAGCGCCCTTCAATGGAGGAAATTGTGAAAATAATGACTCACTTGATGCGGTACTTTCCAGGAGCAGATGAGCCATTACAGTATCCTTGTCAGTATTCAGATGAAGGACAGAGCAACTCTGCCACCAGTACAGGCTCATTCATGGACATTGCTTCTACAAATACGAGTAACAAAAGTGACACTAATATGGAGCAAGTTCCTGCCACAAATGATACTATTAAGCGCTTAGAATCAAAATTGTTGAAAAATCAGGCAAAGCAACAGAGTGAATCTGGACGTTTAAGCTTGGGAGCCTCCCGTGGGAGCAGTGTGGAGAGCTTGCCCCCAACCTCTGAGGGCAAGAGGATGAGTGCTGACATGTCTGAAATAGAAGCTAGGATCGCCGCAACCACAGGCAACGGACAGCCAAGACGTAGATCCATCCAAGACTTGACTGTAACTGGAACAGAACCTGGTCAGGTGAGCAGTAGGTCATCCAGTCCCAGTGTCAGAATGATTACTACCTCAGGACCAACCTCAGAAAAGCCAACTCGAAGTCATCCATGGACCCCTGATGATTCCACAGATACCAATGGATCAGATAACTCCATCCCAATGGCTTATCTTACACTGGATCACCAACTACAGCCTCTAGCACCGTGCCCAAACTCCAAAGAATCTATGGCAGTGTTTGAACAGCATTGTAAAATGGCACAAGAATATATGAAAGTTCAAACAGAAATTGCATTGTTATTACAGAGAAAGCAAGAACTAGTTGCAGAACTGGACCAGGATGAAAAGGACCAGCAAAATACATCTCGCCTGGTACAGGAACATAAAAAGCTTTTAGATGAAAACAAAAGCCTTTCTACTTACTACCAGCAATGCAAAAAACAACTAGAGGTCATCAGAAGTCAGCAGCAGAAACGACAAGGCACTTCATGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T04361-Ab Anti-M3K7/ MAP3K7/ CSCF monoclonal antibody
    Target Antigen GM-Tg-g-T04361-Ag MAP3K7 VLP (virus-like particle)
    ORF Viral Vector pGMAD000624 Human MAP3K7 Adenovirus plasmid
    ORF Viral Vector pGMPC000066 Human MAP3K7 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMAP000498 Human MAP3K7 Adenovirus plasmid
    ORF Viral Vector vGMAD000624 Human MAP3K7 Adenovirus particle
    ORF Viral Vector vGMAP000498 Human MAP3K7 Adenovirus particle


    Target information

    Target ID GM-T04361
    Target Name MAP3K7
    Gene ID 6885, 26409, 703101, 313121, 101095899, 102156745, 529146, 100065841
    Gene Symbol and Synonyms B430101B05,CSCF,FMD2,MAP3K7,MEKK7,TAK1,TGF1a
    Uniprot Accession O43318
    Uniprot Entry Name M3K7_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000135341
    Target Classification Kinase

    The protein encoded by this gene is a member of the serine/threonine protein kinase family. This kinase mediates the signaling transduction induced by TGF beta and morphogenetic protein (BMP), and controls a variety of cell functions including transcription regulation and apoptosis. In response to IL-1, this protein forms a kinase complex including TRAF6, MAP3K7P1/TAB1 and MAP3K7P2/TAB2; this complex is required for the activation of nuclear factor kappa B. This kinase can also activate MAPK8/JNK, MAP2K4/MKK4, and thus plays a role in the cell response to environmental stresses. Four alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.