Human LEP/LEPD/ OB ORF/cDNA clone-Lentivirus particle (NM_000230.2)
Pre-made Human LEP/LEPD/ OB Lentiviral expression plasmid for LEP lentivirus packaging, LEP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to LEP/LEPD products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP001963 | Human LEP Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP001963 |
Gene Name | LEP |
Accession Number | NM_000230.2 |
Gene ID | 3952 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 504 bp |
Gene Alias | LEPD, OB, OBS |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCATTGGGGAACCCTGTGCGGATTCTTGTGGCTTTGGCCCTATCTTTTCTATGTCCAAGCTGTGCCCATCCAAAAAGTCCAAGATGACACCAAAACCCTCATCAAGACAATTGTCACCAGGATCAATGACATTTCACACACGCAGTCAGTCTCCTCCAAACAGAAAGTCACCGGTTTGGACTTCATTCCTGGGCTCCACCCCATCCTGACCTTATCCAAGATGGACCAGACACTGGCAGTCTACCAACAGATCCTCACCAGTATGCCTTCCAGAAACGTGATCCAAATATCCAACGACCTGGAGAACCTCCGGGATCTTCTTCACGTGCTGGCCTTCTCTAAGAGCTGCCACTTGCCCTGGGCCAGTGGCCTGGAGACCTTGGACAGCCTGGGGGGTGTCCTGGAAGCTTCAGGCTACTCCACAGAGGTGGTGGCCCTGAGCAGGCTGCAGGGGTCTCTGCAGGACATGCTGTGGCAGCTGGACCTCAGCCCTGGGTGCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T79485-Ab | Anti-LEP/ LEPD/ OB functional antibody |
Target Antigen | GM-Tg-g-T79485-Ag | LEP protein |
Cytokine | cks-Tg-g-GM-T79485 | leptin (LEP) protein & antibody |
ORF Viral Vector | pGMLV001867 | Human LEP Lentivirus plasmid |
ORF Viral Vector | pGMAD001143 | Rat Lep Adenovirus plasmid |
ORF Viral Vector | pGMLP001963 | Human LEP Lentivirus plasmid |
ORF Viral Vector | vGMLV001867 | Human LEP Lentivirus particle |
ORF Viral Vector | vGMAD001143 | Rat Lep Adenovirus particle |
ORF Viral Vector | vGMLP001963 | Human LEP Lentivirus particle |
Target information
Target ID | GM-T79485 |
Target Name | LEP |
Gene ID | 3952, 16846, 698728, 25608, 493838, 403616, 280836, 100034042 |
Gene Symbol and Synonyms | LEP,LEPD,OB,obese,OBS |
Uniprot Accession | P41159 |
Uniprot Entry Name | LEP_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000174697 |
Target Classification | Not Available |
This gene encodes a protein that is secreted by white adipocytes into the circulation and plays a major role in the regulation of energy homeostasis. Circulating leptin binds to the leptin receptor in the brain, which activates downstream signaling pathways that inhibit feeding and promote energy expenditure. This protein also has several endocrine functions, and is involved in the regulation of immune and inflammatory responses, hematopoiesis, angiogenesis, reproduction, bone formation and wound healing. Mutations in this gene and its regulatory regions cause severe obesity and morbid obesity with hypogonadism in human patients. A mutation in this gene has also been linked to type 2 diabetes mellitus development. [provided by RefSeq, Aug 2017]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.