- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
Sample Application
- • Animal health test
- • In-vitro diagnostics
- • Food & Feed Safety
- • Environmental Safety
- • New drug discovery
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Human CSNK2A2/CK2A2/ CK2alpha' ORF/cDNA clone-Lentivirus particle (NM_001896.2)
Pre-made Human CSNK2A2/CK2A2/ CK2alpha' Lentiviral expression plasmid for CSNK2A2 lentivirus packaging, CSNK2A2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to CSNK2A2/CK2A2 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP004104 | Human CSNK2A2 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP004104 |
| Gene Name | CSNK2A2 |
| Accession Number | NM_001896.2 |
| Gene ID | 1459 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 1053 bp |
| Gene Alias | CK2A2, CK2alpha', CSNK2A1 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| Sequence | ATGCCCGGCCCGGCCGCGGGCAGCAGGGCCCGGGTCTACGCCGAGGTGAACAGTCTGAGGAGCCGCGAGTACTGGGACTACGAGGCTCACGTCCCGAGCTGGGGTAATCAAGATGATTACCAACTGGTTCGAAAACTTGGTCGGGGAAAATATAGTGAAGTATTTGAGGCCATTAATATCACCAACAATGAGAGAGTGGTTGTAAAAATCCTGAAGCCAGTGAAGAAAAAGAAGATAAAACGAGAGGTTAAGATTCTGGAGAACCTTCGTGGTGGAACAAATATCATTAAGCTGATTGACACTGTAAAGGACCCCGTGTCAAAGACACCAGCTTTGGTATTTGAATATATCAATAATACAGATTTTAAGCAACTCTACCAGATCCTGACAGACTTTGATATCCGGTTTTATATGTATGAACTACTTAAAGCTCTGGATTACTGCCACAGCAAGGGAATCATGCACAGGGATGTGAAACCTCACAATGTCATGATAGATCACCAACAGAAAAAGCTGCGACTGATAGATTGGGGTCTGGCAGAATTCTATCATCCTGCTCAGGAGTACAATGTTCGTGTAGCCTCAAGGTACTTCAAGGGACCAGAGCTCCTCGTGGACTATCAGATGTATGATTATAGCTTGGACATGTGGAGTTTGGGCTGTATGTTAGCAAGCATGATCTTTCGAAGGGAACCATTCTTCCATGGACAGGACAACTATGACCAGCTTGTTCGCATTGCCAAGGTTCTGGGTACAGAAGAACTGTATGGGTATCTGAAGAAGTATCACATAGACCTAGATCCACACTTCAACGATATCCTGGGACAACATTCACGGAAACGCTGGGAAAACTTTATCCATAGTGAGAACAGACACCTTGTCAGCCCTGAGGCCCTAGATCTTCTGGACAAACTTCTGCGATACGACCATCAACAGAGACTGACTGCCAAAGAGGCCATGGAGCACCCATACTTCTACCCTGTGGTGAAGGAGCAGTCCCAGCCTTGTGCAGACAATGCTGTGCTTTCCAGTGGTCTCACGGCAGCACGATGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T80526-Ab | Anti-CSNK2A2 monoclonal antibody |
| Target Antigen | GM-Tg-g-T80526-Ag | CSNK2A2 protein |
| ORF Viral Vector | pGMAD000128 | Human CSNK2A2 Adenovirus plasmid |
| ORF Viral Vector | pGMLP004104 | Human CSNK2A2 Lentivirus plasmid |
| ORF Viral Vector | pGMLPm004017 | Human CSNK2A2 Lentivirus plasmid |
| ORF Viral Vector | vGMAD000128 | Human CSNK2A2 Adenovirus particle |
| ORF Viral Vector | vGMLP004104 | Human CSNK2A2 Lentivirus particle |
| ORF Viral Vector | vGMLPm004017 | Human CSNK2A2 Lentivirus particle |
Target information
| Target ID | GM-T80526 |
| Target Name | CSNK2A2 |
| Gene ID | 1459, 13000, 712455, 307641, 101093065, 478108, 282420, 100063080 |
| Gene Symbol and Synonyms | 1110035J23Rik,CK2,CK2A2,CK2alpha',CSNK2A1,CSNK2A2 |
| Uniprot Accession | P19784 |
| Uniprot Entry Name | CSK22_HUMAN |
| Protein Sub-location | Introcelluar Protein |
| Category | Therapeutics Target |
| Disease | Not Available |
| Gene Ensembl | ENSG00000070770 |
| Target Classification | Kinase |
This gene encodes the alpha', or alpha 2, catalytic subunit of the protein kinase enzyme, casein kinase 2 (CK2). Casein kinase 2 is a serine/threonine protein kinase that phosphorylates acidic proteins such as casein. It is involved in various cellular processes, including cell cycle control, apoptosis, and circadian rhythms. This heterotetrameric kinase includes two catalytic subunits, either alpha or alpha', and two regulatory beta subunits. The closely related gene paralog encoding the alpha, or alpha 1 subunit (CSNK2A1, Gene ID: 1457) is found on chromosome 20. An intronic variant in this gene (alpha 2) may be associated with leukocyte telomere length in a South Asian population. A related transcribed pseudogene is found on chromosome 11. [provided by RefSeq, Aug 2017]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
Facebook
LinkedIn
Twitter
