Human SCGB1D1/LIPA/ LPHA ORF/cDNA clone-Lentivirus particle (NM_006552)

Pre-made Human SCGB1D1/LIPA/ LPHA Lentiviral expression plasmid for SCGB1D1 lentivirus packaging, SCGB1D1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to SCGB1D1/LIPA products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004668 Human SCGB1D1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004668
Gene Name SCGB1D1
Accession Number NM_006552
Gene ID 10648
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 273 bp
Gene Alias LIPA, LPHA, LPNA
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGGCTGTCGGTGTGTCTCCTGCTGCTCACGCTGGCCCTTTGCTGCTACCGGGCAAATGCAGTGGTCTGCCAAGCTCTTGGTTCTGAAATCACAGGCTTCTTATTAGCTGGAAAACCTGTGTTCAAGTTCCAACTTGCCAAATTTAAGGCACCTCTGGAAGCTGTTGCAGCCAAGATGGAAGTGAAGAAATGCGTGGATACGATGGCCTATGAGAAAAGAGTGCTAATTACAAAAACATTGGGAAAAATAGCAGAGAAATGTGATCGCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1265-Ab Anti-SG1D1/ SCGB1D1/ LIPA functional antibody
    Target Antigen GM-Tg-g-SE1265-Ag SCGB1D1 protein
    ORF Viral Vector pGMLP004668 Human SCGB1D1 Lentivirus plasmid
    ORF Viral Vector vGMLP004668 Human SCGB1D1 Lentivirus particle


    Target information

    Target ID GM-SE1265
    Target Name SCGB1D1
    Gene ID 10648
    Gene Symbol and Synonyms LIPA,LPHA,LPNA,SCGB1D1
    Uniprot Accession O95968
    Uniprot Entry Name SG1D1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000168515
    Target Classification Not Available

    The protein encoded by this gene is a member of the lipophilin subfamily, part of the uteroglobin superfamily, and is an ortholog of prostatein, the major secretory glycoprotein of the rat ventral prostate gland. This gene product represents one component of a heterodimeric molecule present in human tears whose elution profile is consistent with prostatein, a tetrameric molecule composed of three peptide components in heterodimers. Assuming that human lipophilins are the functional counterparts of prostatein, they may be transcriptionally regulated by steroid hormones, with the ability to bind androgens, other steroids and possibly bind and concentrate estramustine, a chemotherapeutic agent widely used for prostate cancer. Although the gene has been reported to be on chromosome 15, this sequence appears to be from a cluster of genes on chromosome 11 that includes mammaglobin 2. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.