Human SCGB1D1/LIPA/ LPHA ORF/cDNA clone-Lentivirus particle (NM_006552)
Pre-made Human SCGB1D1/LIPA/ LPHA Lentiviral expression plasmid for SCGB1D1 lentivirus packaging, SCGB1D1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to SCGB1D1/LIPA products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP004668 | Human SCGB1D1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP004668 |
Gene Name | SCGB1D1 |
Accession Number | NM_006552 |
Gene ID | 10648 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 273 bp |
Gene Alias | LIPA, LPHA, LPNA |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGGCTGTCGGTGTGTCTCCTGCTGCTCACGCTGGCCCTTTGCTGCTACCGGGCAAATGCAGTGGTCTGCCAAGCTCTTGGTTCTGAAATCACAGGCTTCTTATTAGCTGGAAAACCTGTGTTCAAGTTCCAACTTGCCAAATTTAAGGCACCTCTGGAAGCTGTTGCAGCCAAGATGGAAGTGAAGAAATGCGTGGATACGATGGCCTATGAGAAAAGAGTGCTAATTACAAAAACATTGGGAAAAATAGCAGAGAAATGTGATCGCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1265-Ab | Anti-SG1D1/ SCGB1D1/ LIPA functional antibody |
Target Antigen | GM-Tg-g-SE1265-Ag | SCGB1D1 protein |
ORF Viral Vector | pGMLP004668 | Human SCGB1D1 Lentivirus plasmid |
ORF Viral Vector | vGMLP004668 | Human SCGB1D1 Lentivirus particle |
Target information
Target ID | GM-SE1265 |
Target Name | SCGB1D1 |
Gene ID | 10648 |
Gene Symbol and Synonyms | LIPA,LPHA,LPNA,SCGB1D1 |
Uniprot Accession | O95968 |
Uniprot Entry Name | SG1D1_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000168515 |
Target Classification | Not Available |
The protein encoded by this gene is a member of the lipophilin subfamily, part of the uteroglobin superfamily, and is an ortholog of prostatein, the major secretory glycoprotein of the rat ventral prostate gland. This gene product represents one component of a heterodimeric molecule present in human tears whose elution profile is consistent with prostatein, a tetrameric molecule composed of three peptide components in heterodimers. Assuming that human lipophilins are the functional counterparts of prostatein, they may be transcriptionally regulated by steroid hormones, with the ability to bind androgens, other steroids and possibly bind and concentrate estramustine, a chemotherapeutic agent widely used for prostate cancer. Although the gene has been reported to be on chromosome 15, this sequence appears to be from a cluster of genes on chromosome 11 that includes mammaglobin 2. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.