Human FCGR2A/CD32/ CD32A ORF/cDNA clone-Lentivirus particle (NM_001136219)

Pre-made Human FCGR2A/CD32/ CD32A Lentiviral expression plasmid for FCGR2A lentivirus packaging, FCGR2A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to FCGR2A/CD32 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004748 Human FCGR2A Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004748
Gene Name FCGR2A
Accession Number NM_001136219
Gene ID 2212
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 954 bp
Gene Alias CD32, CD32A, CDw32, FCG2, FcGR, FCGR2, FCGR2A1, IGFR2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACTATGGAGACCCAAATGTCTCAGAATGTATGTCCCAGAAACCTGTGGCTGCTTCAACCATTGACAGTTTTGCTGCTGCTGGCTTCTGCAGACAGTCAAGCTGCAGCTCCCCCAAAGGCTGTGCTGAAACTTGAGCCCCCGTGGATCAACGTGCTCCAGGAGGACTCTGTGACTCTGACATGCCAGGGGGCTCGCAGCCCTGAGAGCGACTCCATTCAGTGGTTCCACAATGGGAATCTCATTCCCACCCACACGCAGCCCAGCTACAGGTTCAAGGCCAACAACAATGACAGCGGGGAGTACACGTGCCAGACTGGCCAGACCAGCCTCAGCGACCCTGTGCATCTGACTGTGCTTTCCGAATGGCTGGTGCTCCAGACCCCTCACCTGGAGTTCCAGGAGGGAGAAACCATCATGCTGAGGTGCCACAGCTGGAAGGACAAGCCTCTGGTCAAGGTCACATTCTTCCAGAATGGAAAATCCCAGAAATTCTCCCATTTGGATCCCACCTTCTCCATCCCACAAGCAAACCACAGTCACAGTGGTGATTACCACTGCACAGGAAACATAGGCTACACGCTGTTCTCATCCAAGCCTGTGACCATCACTGTCCAAGTGCCCAGCATGGGCAGCTCTTCACCAATGGGGATCATTGTGGCTGTGGTCATTGCGACTGCTGTAGCAGCCATTGTTGCTGCTGTAGTGGCCTTGATCTACTGCAGGAAAAAGCGGATTTCAGCCAATTCCACTGATCCTGTGAAGGCTGCCCAATTTGAGCCACCTGGACGTCAAATGATTGCCATCAGAAAGAGACAACTTGAAGAAACCAACAATGACTATGAAACAGCTGACGGCGGCTACATGACTCTGAACCCCAGGGCACCTACTGACGATGATAAAAACATCTACCTGACTCTTCCTCCCAACGACCATGTCAACAGTAATAACTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T22212-Ab Anti-FCG2A/ FCGR2A/ CD32 monoclonal antibody
    Target Antigen GM-Tg-g-T22212-Ag FCGR2A VLP (virus-like particle)
    ORF Viral Vector pGMLP004748 Human FCGR2A Lentivirus plasmid
    ORF Viral Vector vGMLP004748 Human FCGR2A Lentivirus particle


    Target information

    Target ID GM-T22212
    Target Name FCGR2A
    Gene ID 2212, 719996
    Gene Symbol and Synonyms CD32,CD32A,CDw32,FCG2,FcgammaRIIa,FcGR,FCGR2,FCGR2A,FCGR2A1,FGCR,IGFR2
    Uniprot Accession P12318
    Uniprot Entry Name FCG2A_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Cancer
    Gene Ensembl ENSG00000143226
    Target Classification Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA)

    This gene encodes one member of a family of immunoglobulin Fc receptor genes found on the surface of many immune response cells. The protein encoded by this gene is a cell surface receptor found on phagocytic cells such as macrophages and neutrophils, and is involved in the process of phagocytosis and clearing of immune complexes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.