- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
Sample Application
- • Animal health test
- • In-vitro diagnostics
- • Food & Feed Safety
- • Environmental Safety
- • New drug discovery
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Human TNFSF13/APRIL/ CD256 ORF/cDNA clone-Lentivirus particle (NM_003808)
Pre-made Human TNFSF13/APRIL/ CD256 Lentiviral expression plasmid for TNFSF13 lentivirus packaging, TNFSF13 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to APRIL/TNFSF13 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP005046 | Human TNFSF13 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP005046 |
| Gene Name | TNFSF13 |
| Accession Number | NM_003808 |
| Gene ID | 8741 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 753 bp |
| Gene Alias | APRIL, CD256, TALL-2, TALL2, TNLG7B, TRDL-1, UNQ383/PRO715, ZTNF2 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| Sequence | ATGCCAGCCTCATCTCCTTTCTTGCTAGCCCCCAAAGGGCCTCCAGGCAACATGGGGGGCCCAGTCAGAGAGCCGGCACTCTCAGTTGCCCTCTGGTTGAGTTGGGGGGCAGCTCTGGGGGCCGTGGCTTGTGCCATGGCTCTGCTGACCCAACAAACAGAGCTGCAGAGCCTCAGGAGAGAGGTGAGCCGGCTGCAGGGGACAGGAGGCCCCTCCCAGAATGGGGAAGGGTATCCCTGGCAGAGTCTCCCGGAGCAGAGTTCCGATGCCCTGGAAGCCTGGGAGAATGGGGAGAGATCCCGGAAAAGGAGAGCAGTGCTCACCCAAAAACAGAAGAAGCAGCACTCTGTCCTGCACCTGGTTCCCATTAACGCCACCTCCAAGGATGACTCCGATGTGACAGAGGTGATGTGGCAACCAGCTCTTAGGCGTGGGAGAGGCCTACAGGCCCAAGGATATGGTGTCCGAATCCAGGATGCTGGAGTTTATCTGCTGTATAGCCAGGTCCTGTTTCAAGACGTGACTTTCACCATGGGTCAGGTGGTGTCTCGAGAAGGCCAAGGAAGGCAGGAGACTCTATTCCGATGTATAAGAAGTATGCCCTCCCACCCGGACCGGGCCTACAACAGCTGCTATAGCGCAGGTGTCTTCCATTTACACCAAGGGGATATTCTGAGTGTCATAATTCCCCGGGCAAGGGCGAAACTTAACCTCTCTCCACATGGAACCTTCCTGGGGTTTGTGAAACTGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Biosimilar | GMP-Bios-ab-518 | Pre-Made Sibeprenlimab biosimilar, Whole mAb, Anti-TNFSF13/APRIL Antibody: Anti-CD256/TALL-2/TALL2/TNLG7B/TRDL-1/UNQ383/PRO715/ZTNF2 therapeutic antibody |
| Biosimilar | GMP-Bios-INN-742 | Pre-Made Atacicept Biosimilar, Fusion Protein targeting TNFSF13/APRIL fused with human IGHG1 Fc (Fragment constant): Recombinant therapeutic protein targeting CD256/TALL-2/TALL2/TNLG7B/TRDL-1/UNQ383/PRO715/ZTNF2 |
| Target Antibody | GM-Tg-g-T14676-Ab | Anti-TNF13/ APRIL/ TNFSF13 functional antibody |
| Target Antigen | GM-Tg-g-T14676-Ag | APRIL/TNFSF13 protein |
| Cytokine | cks-Tg-g-GM-T14676 | tumor necrosis factor (ligand) superfamily, member 13 (TNFSF13) protein & antibody |
| ORF Viral Vector | pGMLP005046 | Human TNFSF13 Lentivirus plasmid |
| ORF Viral Vector | vGMLP005046 | Human TNFSF13 Lentivirus particle |
Target information
| Target ID | GM-T14676 |
| Target Name | APRIL |
| Gene ID | 8741, 69583, 100551507, 287437, 100328582, 100568281, 538567, 100147233 |
| Gene Symbol and Synonyms | 2310026N09Rik,APRIL,CD256,TALL-2,TALL2,TNFSF13,TNLG7B,TRDL-1,Trdl1,UNQ383/PRO715,ZTNF2 |
| Uniprot Accession | O75888 |
| Uniprot Entry Name | TNF13_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target |
| Disease | Lupus Glomerulonephritis |
| Gene Ensembl | ENSG00000161955 |
| Target Classification | Checkpoint-Immuno Oncology |
The protein encoded by this gene is a member of the tumor necrosis factor (TNF) ligand family. This protein is a ligand for TNFRSF17/BCMA, a member of the TNF receptor family. This protein and its receptor are both found to be important for B cell development. In vitro experiments suggested that this protein may be able to induce apoptosis through its interaction with other TNF receptor family proteins such as TNFRSF6/FAS and TNFRSF14/HVEM. Alternative splicing results in multiple transcript variants. Some transcripts that skip the last exon of the upstream gene (TNFSF12) and continue into the second exon of this gene have been identified; such read-through transcripts are contained in GeneID 407977, TNFSF12-TNFSF13. [provided by RefSeq, Oct 2010]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
Facebook
LinkedIn
Twitter
