Human CCL20/CKb4/ Exodus ORF/cDNA clone-Adeno-associate virus(AAV) plasmid (NM_001130046.2)
Pre-made Human CCL20/CKb4/ Exodus Adeno-associated virus expression plasmid (ITR-vector) for CCL20 AAV packaging, CCL20 AAV production.The purified Human CCL20/CKb4/ Exodus AAV particle serves as an invaluable asset for in-depth in vivo CCL20 studies, mechanism of action (MOA) research, and the evolution of CCL20-associated gene therapy strategies.
Our GM-AAV ITR vector is optimized with the G-NEXT™ multi-serotypes AAV vector system. Explore the G-NEXT™ system in detail.
Go
to CCL20/CKb4 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAAV000788 | Human CCL20 Adeno-associate virus(AAV) plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAAV000788 |
Gene Name | CCL20 |
Accession Number | NM_001130046.2 |
Gene ID | 6364 |
Species | Human |
Product Type | Adeno-associate virus(AAV) plasmid (overexpression) |
Insert Length | 288 bp |
Gene Alias | CKb4, Exodus, LARC, MIP-3-alpha, MIP-3a, MIP3A, SCYA20, ST38 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTGCTGTACCAAGAGTTTGCTCCTGGCTGCTTTGATGTCAGTGCTGCTACTCCACCTCTGCGGCGAATCAGAAGCAAGCAACTTTGACTGCTGTCTTGGATACACAGACCGTATTCTTCATCCTAAATTTATTGTGGGCTTCACACGGCAGCTGGCCAATGAAGGCTGTGACATCAATGCTATCATCTTTCACACAAAGAAAAAGTTGTCTGTGTGCGCAAATCCAAAACAGACTTGGGTGAAATATATTGTGCGTCTCCTCAGTAAAAAAGTCAAGAACATGTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T04894-Ab | Anti-CCL20/ CKb4/ Exodus functional antibody |
Target Antigen | GM-Tg-g-T04894-Ag | CCL20 protein |
Cytokine | cks-Tg-g-GM-T04894 | chemokine (C-C motif) ligand 20 (CCL20) protein & antibody |
ORF Viral Vector | pGMLV000235 | Human CCL20 Lentivirus plasmid |
ORF Viral Vector | pGMAAV000788 | Human CCL20 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | vGMLV000235 | Human CCL20 Lentivirus particle |
ORF Viral Vector | vGMAAV000788 | Human CCL20 Adeno-associate virus(AAV) particle |
Target information
Target ID | GM-T04894 |
Target Name | CCL20 |
Gene ID | 6364, 20297, 574182, 29538, 101089032, 448790, 281666, 100629808 |
Gene Symbol and Synonyms | CCL20,CKb4,Exodus,exodus-1,LARC,MIP-3-alpha,MIP-3a,MIP-3[a],MIP3A,SCYA20,ST38 |
Uniprot Accession | P78556 |
Uniprot Entry Name | CCL20_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Immuno-oncology Target, Cytokine Target |
Disease | Prostate Cancer |
Gene Ensembl | ENSG00000115009 |
Target Classification | Checkpoint-Immuno Oncology |
This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The protein encoded by this gene displays chemotactic activity for lymphocytes and can repress proliferation of myeloid progenitors. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.