Human CCL20/CKb4/ Exodus ORF/cDNA clone-Adeno-associate virus(AAV) plasmid (NM_001130046.2)

Pre-made Human CCL20/CKb4/ Exodus Adeno-associated virus expression plasmid (ITR-vector) for CCL20 AAV packaging, CCL20 AAV production.The purified Human CCL20/CKb4/ Exodus AAV particle serves as an invaluable asset for in-depth in vivo CCL20 studies, mechanism of action (MOA) research, and the evolution of CCL20-associated gene therapy strategies.

Our GM-AAV ITR vector is optimized with the G-NEXT™ multi-serotypes AAV vector system. Explore the G-NEXT™ system in detail.

Target products collectionGo to CCL20/CKb4 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAAV000788 Human CCL20 Adeno-associate virus(AAV) plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAAV000788
Gene Name CCL20
Accession Number NM_001130046.2
Gene ID 6364
Species Human
Product Type Adeno-associate virus(AAV) plasmid (overexpression)
Insert Length 288 bp
Gene Alias CKb4, Exodus, LARC, MIP-3-alpha, MIP-3a, MIP3A, SCYA20, ST38
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTGCTGTACCAAGAGTTTGCTCCTGGCTGCTTTGATGTCAGTGCTGCTACTCCACCTCTGCGGCGAATCAGAAGCAAGCAACTTTGACTGCTGTCTTGGATACACAGACCGTATTCTTCATCCTAAATTTATTGTGGGCTTCACACGGCAGCTGGCCAATGAAGGCTGTGACATCAATGCTATCATCTTTCACACAAAGAAAAAGTTGTCTGTGTGCGCAAATCCAAAACAGACTTGGGTGAAATATATTGTGCGTCTCCTCAGTAAAAAAGTCAAGAACATGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T04894-Ab Anti-CCL20/ CKb4/ Exodus functional antibody
    Target Antigen GM-Tg-g-T04894-Ag CCL20 protein
    Cytokine cks-Tg-g-GM-T04894 chemokine (C-C motif) ligand 20 (CCL20) protein & antibody
    ORF Viral Vector pGMLV000235 Human CCL20 Lentivirus plasmid
    ORF Viral Vector pGMAAV000788 Human CCL20 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector vGMLV000235 Human CCL20 Lentivirus particle
    ORF Viral Vector vGMAAV000788 Human CCL20 Adeno-associate virus(AAV) particle


    Target information

    Target ID GM-T04894
    Target Name CCL20
    Gene ID 6364, 20297, 574182, 29538, 101089032, 448790, 281666, 100629808
    Gene Symbol and Synonyms CCL20,CKb4,Exodus,exodus-1,LARC,MIP-3-alpha,MIP-3a,MIP-3[a],MIP3A,SCYA20,ST38
    Uniprot Accession P78556
    Uniprot Entry Name CCL20_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Immuno-oncology Target, Cytokine Target
    Disease Prostate Cancer
    Gene Ensembl ENSG00000115009
    Target Classification Checkpoint-Immuno Oncology

    This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The protein encoded by this gene displays chemotactic activity for lymphocytes and can repress proliferation of myeloid progenitors. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.