Human ALKBH1/ABH/ ABH1 ORF/cDNA clone-Adeno-associate virus(AAV) plasmid (NM_006020.3)
Pre-made Human ALKBH1/ABH/ ABH1 Adeno-associated virus expression plasmid (ITR-vector) for ALKBH1 AAV packaging, ALKBH1 AAV production.The purified Human ALKBH1/ABH/ ABH1 AAV particle serves as an invaluable asset for in-depth in vivo ALKBH1 studies, mechanism of action (MOA) research, and the evolution of ALKBH1-associated gene therapy strategies.
Our GM-AAV ITR vector is optimized with the G-NEXT™ multi-serotypes AAV vector system. Explore the G-NEXT™ system in detail.
Go
to ALKBH1/ABH products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAAV000909 | Human ALKBH1 Adeno-associate virus(AAV) plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAAV000909 |
Gene Name | ALKBH1 |
Accession Number | NM_006020.3 |
Gene ID | 8846 |
Species | Human |
Product Type | Adeno-associate virus(AAV) plasmid (overexpression) |
Insert Length | 1170 bp |
Gene Alias | ABH, ABH1, alkB, ALKBH, hABH |
Fluorescent Reporter | |
Mammalian Cell Selection | Null |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGGAAGATGGCAGCGGCCGTGGGCTCTGTGGCGACTCTGGCGACTGAGCCCGGGGAGGACGCCTTTCGGAAACTTTTCCGCTTCTACCGTCAGAGCCGGCCCGGGACCGCAGACCTGGAAGGGGTCATCGACTTCTCGGCGGCCCACGCAGCCCGTGGCAAGGGTCCTGGTGCCCAAAAGGTGATCAAATCTCAGCTAAATGTGTCTTCTGTCAGTGAGCAGAATGCATATAGAGCAGGTCTTCAGCCCGTCAGCAAGTGGCAAGCCTATGGACTCAAAGGCTATCCTGGGTTTATTTTTATCCCAAACCCCTTCCTCCCAGGTTACCAGTGGCACTGGGTGAAACAGTGCCTTAAGTTATATTCCCAGAAACCTAATGTATGTAACCTGGACAAACACATGTCTAAAGAAGAGACCCAAGATCTGTGGGAACAGAGCAAAGAGTTCCTGAGGTATAAAGAAGCGACTAAACGGAGACCCCGAAGTTTACTGGAGAAACTGCGTTGGGTGACCGTAGGCTACCATTATAACTGGGACAGTAAGAAATACTCAGCAGATCATTACACACCTTTCCCTTCTGACCTGGGTTTCCTCTCAGAGCAAGTAGCCGCTGCCTGTGGATTTGAGGATTTCCGAGCTGAAGCAGGGATCCTGAATTACTACCGCCTGGACTCCACACTGGGAATCCACGTAGACAGATCTGAGCTAGATCACTCCAAACCCTTGCTGTCATTCAGCTTTGGACAGTCCGCCATCTTTCTCCTGGGTGGTCTTCAAAGGGATGAGGCCCCCACGGCCATGTTTATGCACAGTGGTGACATCATGATAATGTCGGGTTTCAGCCGCCTCTTGAACCACGCAGTCCCTCGTGTCCTTCCAAATCCAGAAGGGGAAGGCCTGCCTCACTGCCTAGAGGCACCTCTCCCTGCTGTCCTCCCGAGAGATTCAATGGTAGAGCCTTGTTCTATGGAGGACTGGCAGGTGTGTGCCAGCTACTTGAAGACCGCTCGTGTTAACATGACTGTCCGACAGGTCCTGGCCACAGACCAGAATTTCCCTCTAGAACCCATCGAGGATGAAAAAAGAGACATCAGTACAGAAGGTTTCTGCCATCTGGATGACCAGAATAGCGAAGTAAAACGGGCCAGGATAAACCCTGACAGCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1438-Ab | Anti-ALKB1/ ALKBH1/ ABH functional antibody |
Target Antigen | GM-Tg-g-SE1438-Ag | ALKBH1 protein |
ORF Viral Vector | pGMAAV000909 | Human ALKBH1 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMLP001188 | Human ALKBH1 Lentivirus plasmid |
ORF Viral Vector | pGMLP004079 | Human ALKBH1 Lentivirus plasmid |
ORF Viral Vector | vGMAAV000909 | Human ALKBH1 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMLP001188 | Human ALKBH1 Lentivirus particle |
ORF Viral Vector | vGMLP004079 | Human ALKBH1 Lentivirus particle |
Target information
Target ID | GM-SE1438 |
Target Name | ALKBH1 |
Gene ID | 8846, 211064, 706760, 362766, 101081308, 480404, 538733, 100059544 |
Gene Symbol and Synonyms | 2700073G19Rik,ABH,ABH1,alkB,ALKBH,ALKBH1,hABH |
Uniprot Accession | Q13686 |
Uniprot Entry Name | ALKB1_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000100601 |
Target Classification | Not Available |
This gene encodes a homolog to the E. coli alkB gene product. The E. coli alkB protein is part of the adaptive response mechanism of DNA alkylation damage repair. It is involved in damage reversal by oxidative demethylation of 1-methyladenine and 3-methylcytosine. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.