- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
Sample Application
- • Animal health test
- • In-vitro diagnostics
- • Food & Feed Safety
- • Environmental Safety
- • New drug discovery
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Human ALKBH1/ABH/ ABH1 ORF/cDNA clone-Adeno-associate virus(AAV) particle (NM_006020.3)
Pre-made Human ALKBH1/ABH/ ABH1 Adeno-associated virus particle for ALKBH1 in-vivo study, mechanism of action (MOA) research and ALKBH1-associated gene therapy development.
At GM Vector Core (GMVC), we stand at the forefront of custom AAV development and produce distinct grades of AAVs employing state-of-the-art methodologies. Uncover more about our expertise.
Go
to ALKBH1/ABH products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | AAV serotype | AAV Grade | AAV quantity |
| vGMAAV000909 | Human ALKBH1 Adeno-associate virus(AAV) particle | AAV1, AAV2, AAV2 variant (Y444F), AAV2 variant (Y272F, Y444F, Y500F, Y730F), AAV2 variant (Y444F, Y730F, Y500F, Y272F, Y704F, Y252F), AAV2 variant(AAV2.7m8), AAV5, AAV6, AAV8, AAV8-1m, AAV8-2m, AAV8 variant (Y733F, Y447F, Y275), AAV9, AAV-Rh.10, AAV-DJ, AAV-DJ/8, AAV-Retro (Retrograde), AAV9-PHP.B, AAV9-PHP.eB, AAV9-PHP.S, AAV-BR1, AAV-2i8, AAV-SIG, AAV-VEC, AAV4, AAV6.2, AAV6.2FF | Pilot Grade | 1.0E+12VG/ml |
| 5.0E+12VG/ml | ||||
| 1E+13VG/ml | ||||
| 5E+13VG/ml | ||||
| 1E+14VG/ml | ||||
| Research Grade | 1.0E+12VG/ml | |||
| 5.0E+12VG/ml | ||||
| 1E+13VG/ml | ||||
| 5E+13VG/ml | ||||
| 1E+14VG/ml | ||||
| GMP-like Grade | inquiry | |||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAAV000909 |
| Gene Name | ALKBH1 |
| Accession Number | NM_006020.3 |
| Gene ID | 8846 |
| Species | Human |
| Product Type | Adeno-associate virus(AAV) particle (overexpression) |
| Insert Length | 1170 bp |
| Gene Alias | ABH, ABH1, alkB, ALKBH, hABH |
| Fluorescent Reporter | |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| Sequence | ATGGGGAAGATGGCAGCGGCCGTGGGCTCTGTGGCGACTCTGGCGACTGAGCCCGGGGAGGACGCCTTTCGGAAACTTTTCCGCTTCTACCGTCAGAGCCGGCCCGGGACCGCAGACCTGGAAGGGGTCATCGACTTCTCGGCGGCCCACGCAGCCCGTGGCAAGGGTCCTGGTGCCCAAAAGGTGATCAAATCTCAGCTAAATGTGTCTTCTGTCAGTGAGCAGAATGCATATAGAGCAGGTCTTCAGCCCGTCAGCAAGTGGCAAGCCTATGGACTCAAAGGCTATCCTGGGTTTATTTTTATCCCAAACCCCTTCCTCCCAGGTTACCAGTGGCACTGGGTGAAACAGTGCCTTAAGTTATATTCCCAGAAACCTAATGTATGTAACCTGGACAAACACATGTCTAAAGAAGAGACCCAAGATCTGTGGGAACAGAGCAAAGAGTTCCTGAGGTATAAAGAAGCGACTAAACGGAGACCCCGAAGTTTACTGGAGAAACTGCGTTGGGTGACCGTAGGCTACCATTATAACTGGGACAGTAAGAAATACTCAGCAGATCATTACACACCTTTCCCTTCTGACCTGGGTTTCCTCTCAGAGCAAGTAGCCGCTGCCTGTGGATTTGAGGATTTCCGAGCTGAAGCAGGGATCCTGAATTACTACCGCCTGGACTCCACACTGGGAATCCACGTAGACAGATCTGAGCTAGATCACTCCAAACCCTTGCTGTCATTCAGCTTTGGACAGTCCGCCATCTTTCTCCTGGGTGGTCTTCAAAGGGATGAGGCCCCCACGGCCATGTTTATGCACAGTGGTGACATCATGATAATGTCGGGTTTCAGCCGCCTCTTGAACCACGCAGTCCCTCGTGTCCTTCCAAATCCAGAAGGGGAAGGCCTGCCTCACTGCCTAGAGGCACCTCTCCCTGCTGTCCTCCCGAGAGATTCAATGGTAGAGCCTTGTTCTATGGAGGACTGGCAGGTGTGTGCCAGCTACTTGAAGACCGCTCGTGTTAACATGACTGTCCGACAGGTCCTGGCCACAGACCAGAATTTCCCTCTAGAACCCATCGAGGATGAAAAAAGAGACATCAGTACAGAAGGTTTCTGCCATCTGGATGACCAGAATAGCGAAGTAAAACGGGCCAGGATAAACCCTGACAGCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-SE1438-Ab | Anti-ALKB1/ ALKBH1/ ABH functional antibody |
| Target Antigen | GM-Tg-g-SE1438-Ag | ALKBH1 protein |
| ORF Viral Vector | pGMAAV000909 | Human ALKBH1 Adeno-associate virus(AAV) plasmid |
| ORF Viral Vector | pGMLP001188 | Human ALKBH1 Lentivirus plasmid |
| ORF Viral Vector | pGMLP004079 | Human ALKBH1 Lentivirus plasmid |
| ORF Viral Vector | vGMAAV000909 | Human ALKBH1 Adeno-associate virus(AAV) particle |
| ORF Viral Vector | vGMLP001188 | Human ALKBH1 Lentivirus particle |
| ORF Viral Vector | vGMLP004079 | Human ALKBH1 Lentivirus particle |
Target information
| Target ID | GM-SE1438 |
| Target Name | ALKBH1 |
| Gene ID | 8846, 211064, 706760, 362766, 101081308, 480404, 538733, 100059544 |
| Gene Symbol and Synonyms | 2700073G19Rik,ABH,ABH1,alkB,ALKBH,ALKBH1,hABH |
| Uniprot Accession | Q13686 |
| Uniprot Entry Name | ALKB1_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000100601 |
| Target Classification | Not Available |
This gene encodes a homolog to the E. coli alkB gene product. The E. coli alkB protein is part of the adaptive response mechanism of DNA alkylation damage repair. It is involved in damage reversal by oxidative demethylation of 1-methyladenine and 3-methylcytosine. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
Facebook
LinkedIn
Twitter
