Human ALKBH1/ABH/ alkB ORF/cDNA clone-Lentivirus particle (BC025787)

Pre-made Human ALKBH1/ABH/ alkB Lentiviral expression plasmid for ALKBH1 lentivirus packaging, ALKBH1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to ALKBH1/ABH products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP004079 Human ALKBH1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP004079
Gene Name ALKBH1
Accession Number BC025787
Gene ID 8846
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1170 bp
Gene Alias ABH, alkB, hABH
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGGAAGATGGCAGCGGCCGTGGGCTCTGTGGCGACTCTGGCGACTGAGCCCGGGGAGGACGCCTTTCGGAAACTTTTCCGCTTCTACCGTCAGAGCCGGCCCGGGACCGCAGACCTGGAAGGGGTCATCGACTTCTCGGCGGCCCACGCAGCCCGTGGCAAGGGTCCTGGTGCCCAAAAGGTGATCAAATCTCAGCTAAATGTGTCTTCTGTCAGTGAGCAGAATGCATATAGAGCAGGTCTTCAGCCCGTCAGCAAGTGGCAAGCCTATGGACTCAAAGGCTATCCTGGGTTTATTTTTATCCCAAACCCCTTCCTCCCAGGTTACCAGTGGCACTGGGTGAAACAGTGCCTTAAGTTATATTCCCAGAAACCTAATGTATGTAACCTGGACAAACACATGTCTAAAGAAGAGACCCAAGATCTGTGGGAACAGAGCAAAGAGTTCCTGAGGTATAAAGAAGCGACTAAACGGAGACCCCGAAGTTTACTGGAGAAACTGCGTTGGGTGACCGTAGGCTACCATTATAACTGGGACAGTAAGAAATACTCAGCAGATCATTACACACCTTTCCCTTCTGACCTGGGTTTCCTCTCAGAGCAAGTAGCCGCTGCCTGTGGATTTGAGGATTTCCGAGCTGAAGCAGGGATCCTGAATTACTACCGCCTGGACTCCACACTGGGAATCCACGTAGACAGATCTGAGCTAGATCACTCCAAACCCTTGCTGTCATTCAGCTTTGGACAGTCCGCCATCTTTCTCCTGGGTGGTCTTCAAAGGGATGAGGCCCCCACGGCCATGTTTATGCACAGTGGTGACATCATGATAATGTCGGGTTTCAGCCGCCTCTTGAACCACGCAGTCCCTCGTGTCCTTCCAAATCCAGAAGGGGAAGGCCTGCCTCACTGCCTAGAGGCACCTCTCCCTGCTGTCCTCCCGAGAGATTCAATGGTAGAGCCTTGTTCTATGGAGGACTGGCAGGTGTGTGCCAGCTACTTGAAGACCGCTCGTGTTAACATGACTGTCCGACAGGTCCTGGCCACAGACCAGAATTTCCCTCTAGAACCCATCGAGGATGAAAAAAGAGACATCAGTACAGAAGGTTTCTGCCATCTGGATGACCAGAATAGCGAAGTAAAACGGGCCAGGATAAACCCTCACAGCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1438-Ab Anti-ALKB1/ ALKBH1/ ABH functional antibody
    Target Antigen GM-Tg-g-SE1438-Ag ALKBH1 protein
    ORF Viral Vector pGMAAV000909 Human ALKBH1 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMLP001188 Human ALKBH1 Lentivirus plasmid
    ORF Viral Vector pGMLP004079 Human ALKBH1 Lentivirus plasmid
    ORF Viral Vector vGMAAV000909 Human ALKBH1 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMLP001188 Human ALKBH1 Lentivirus particle
    ORF Viral Vector vGMLP004079 Human ALKBH1 Lentivirus particle


    Target information

    Target ID GM-SE1438
    Target Name ALKBH1
    Gene ID 8846, 211064, 706760, 362766, 101081308, 480404, 538733, 100059544
    Gene Symbol and Synonyms 2700073G19Rik,ABH,ABH1,alkB,ALKBH,ALKBH1,hABH
    Uniprot Accession Q13686
    Uniprot Entry Name ALKB1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000100601
    Target Classification Not Available

    This gene encodes a homolog to the E. coli alkB gene product. The E. coli alkB protein is part of the adaptive response mechanism of DNA alkylation damage repair. It is involved in damage reversal by oxidative demethylation of 1-methyladenine and 3-methylcytosine. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.