Human ADORA2A/A2aR/ ADORA2 ORF/cDNA clone-Adeno-associate virus(AAV) plasmid (NM_001278497)

Pre-made Human ADORA2A/A2aR/ ADORA2 Adeno-associated virus expression plasmid (ITR-vector) for ADORA2A AAV packaging, ADORA2A AAV production.The purified Human ADORA2A/A2aR/ ADORA2 AAV particle serves as an invaluable asset for in-depth in vivo ADORA2A studies, mechanism of action (MOA) research, and the evolution of ADORA2A-associated gene therapy strategies.

Our GM-AAV ITR vector is optimized with the G-NEXT™ multi-serotypes AAV vector system. Explore the G-NEXT™ system in detail.

Target products collectionGo to ADORA2A/A2aR products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAAV001052 Human ADORA2A Adeno-associate virus(AAV) plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAAV001052
Gene Name ADORA2A
Accession Number NM_001278497
Gene ID 135
Species Human
Product Type Adeno-associate virus(AAV) plasmid (overexpression)
Insert Length 1239 bp
Gene Alias A2aR, ADORA2, RDC8
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag Null
Promoter CMV
Resistance Amplicin
Sequence ATGCCCATCATGGGCTCCTCGGTGTACATCACGGTGGAGCTGGCCATTGCTGTGCTGGCCATCCTGGGCAATGTGCTGGTGTGCTGGGCCGTGTGGCTCAACAGCAACCTGCAGAACGTCACCAACTACTTTGTGGTGTCACTGGCGGCGGCCGACATCGCAGTGGGTGTGCTCGCCATCCCCTTTGCCATCACCATCAGCACCGGGTTCTGCGCTGCCTGCCACGGCTGCCTCTTCATTGCCTGCTTCGTCCTGGTCCTCACGCAGAGCTCCATCTTCAGTCTCCTGGCCATCGCCATTGACCGCTACATTGCCATCCGCATCCCGCTCCGGTACAATGGCTTGGTGACCGGCACGAGGGCTAAGGGCATCATTGCCATCTGCTGGGTGCTGTCGTTTGCCATCGGCCTGACTCCCATGCTAGGTTGGAACAACTGCGGTCAGCCAAAGGAGGGCAAGAACCACTCCCAGGGCTGCGGGGAGGGCCAAGTGGCCTGTCTCTTTGAGGATGTGGTCCCCATGAACTACATGGTGTACTTCAACTTCTTTGCCTGTGTGCTGGTGCCCCTGCTGCTCATGCTGGGTGTCTATTTGCGGATCTTCCTGGCGGCGCGACGACAGCTGAAGCAGATGGAGAGCCAGCCTCTGCCGGGGGAGCGGGCACGGTCCACACTGCAGAAGGAGGTCCATGCTGCCAAGTCACTGGCCATCATTGTGGGGCTCTTTGCCCTCTGCTGGCTGCCCCTACACATCATCAACTGCTTCACTTTCTTCTGCCCCGACTGCAGCCACGCCCCTCTCTGGCTCATGTACCTGGCCATCGTCCTCTCCCACACCAATTCGGTTGTGAATCCCTTCATCTACGCCTACCGTATCCGCGAGTTCCGCCAGACCTTCCGCAAGATCATTCGCAGCCACGTCCTGAGGCAGCAAGAACCTTTCAAGGCAGCTGGCACCAGTGCCCGGGTCTTGGCAGCTCATGGCAGTGACGGAGAGCAGGTCAGCCTCCGTCTCAACGGCCACCCGCCAGGAGTGTGGGCCAACGGCAGTGCTCCCCACCCTGAGCGGAGGCCCAATGGCTATGCCCTGGGGCTGGTGAGTGGAGGGAGTGCCCAAGAGTCCCAGGGGAACACGGGCCTCCCAGACGTGGAGCTCCTTAGCCATGAGCTCAAGGGAGTGTGCCCAGAGCCCCCTGGCCTAGATGACCCCCTGGCCCAGGATGGAGCAGGAGTGTCCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T77365-Ab Anti-AA2AR/ ADORA2A/ A2aR monoclonal antibody
    Target Antigen GM-Tg-g-T77365-Ag ADORA2A VLP (virus-like particle)
    ORF Viral Vector pGMAAV000023 Human ADORA2A Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV000313 Human ADORA2A Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV001052 Human ADORA2A Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAP000328 Human ADORA2A Adenovirus plasmid
    ORF Viral Vector vGMAAV000023 Human ADORA2A Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV000313 Human ADORA2A Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV001052 Human ADORA2A Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAP000328 Human ADORA2A Adenovirus particle


    Target information

    Target ID GM-T77365
    Target Name ADORA2A
    Gene ID 135, 11540, 707865, 25369, 101080742, 403960, 617828, 100034039
    Gene Symbol and Synonyms A2AAR,A2aR,AA2AR,ADENO,ADORA2,ADORA2A,Adora2l1,ARA2A,RDC8
    Uniprot Accession P29274
    Uniprot Entry Name AA2AR_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Not Available
    Gene Ensembl ENSG00000128271
    Target Classification Checkpoint-Immuno Oncology

    This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor (GPCR) superfamily, which is subdivided into classes and subtypes. The receptors are seven-pass transmembrane proteins that respond to extracellular cues and activate intracellular signal transduction pathways. This protein, an adenosine receptor of A2A subtype, uses adenosine as the preferred endogenous agonist and preferentially interacts with the G(s) and G(olf) family of G proteins to increase intracellular cAMP levels. It plays an important role in many biological functions, such as cardiac rhythm and circulation, cerebral and renal blood flow, immune function, pain regulation, and sleep. It has been implicated in pathophysiological conditions such as inflammatory diseases and neurodegenerative disorders. Alternative splicing results in multiple transcript variants. A read-through transcript composed of the upstream SPECC1L (sperm antigen with calponin homology and coiled-coil domains 1-like) and ADORA2A (adenosine A2a receptor) gene sequence has been identified, but it is thought to be non-coding. [provided by RefSeq, Jun 2013]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.