Human ADORA2A/A2aR/ ADORA2 ORF/cDNA clone-Adeno-associate virus(AAV) particle (NM_001278497)
Pre-made Human ADORA2A/A2aR/ ADORA2 Adeno-associated virus particle for ADORA2A in-vivo study, mechanism of action (MOA) research and ADORA2A-associated gene therapy development.
At GM Vector Core (GMVC), we stand at the forefront of custom AAV development and produce distinct grades of AAVs employing state-of-the-art methodologies. Uncover more about our expertise.
Go
to ADORA2A/A2aR products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | AAV serotype | AAV Grade | AAV quantity |
vGMAAV001052 | Human ADORA2A Adeno-associate virus(AAV) particle | AAV1, AAV2, AAV2 variant (Y444F), AAV2 variant (Y272F, Y444F, Y500F, Y730F), AAV2 variant (Y444F, Y730F, Y500F, Y272F, Y704F, Y252F), AAV2 variant(AAV2.7m8), AAV5, AAV6, AAV8, AAV8-1m, AAV8-2m, AAV8 variant (Y733F, Y447F, Y275), AAV9, AAV-Rh.10, AAV-DJ, AAV-DJ/8, AAV-Retro (Retrograde), AAV9-PHP.B, AAV9-PHP.eB, AAV9-PHP.S, AAV-BR1, AAV-2i8, AAV-SIG, AAV-VEC, AAV4, AAV6.2, AAV6.2FF | Pilot Grade | 1.0E+12VG/ml |
5.0E+12VG/ml | ||||
1E+13VG/ml | ||||
5E+13VG/ml | ||||
1E+14VG/ml | ||||
Research Grade | 1.0E+12VG/ml | |||
5.0E+12VG/ml | ||||
1E+13VG/ml | ||||
5E+13VG/ml | ||||
1E+14VG/ml | ||||
GMP-like Grade | inquiry | |||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAAV001052 |
Gene Name | ADORA2A |
Accession Number | NM_001278497 |
Gene ID | 135 |
Species | Human |
Product Type | Adeno-associate virus(AAV) particle (overexpression) |
Insert Length | 1239 bp |
Gene Alias | A2aR, ADORA2, RDC8 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | Null |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCCCATCATGGGCTCCTCGGTGTACATCACGGTGGAGCTGGCCATTGCTGTGCTGGCCATCCTGGGCAATGTGCTGGTGTGCTGGGCCGTGTGGCTCAACAGCAACCTGCAGAACGTCACCAACTACTTTGTGGTGTCACTGGCGGCGGCCGACATCGCAGTGGGTGTGCTCGCCATCCCCTTTGCCATCACCATCAGCACCGGGTTCTGCGCTGCCTGCCACGGCTGCCTCTTCATTGCCTGCTTCGTCCTGGTCCTCACGCAGAGCTCCATCTTCAGTCTCCTGGCCATCGCCATTGACCGCTACATTGCCATCCGCATCCCGCTCCGGTACAATGGCTTGGTGACCGGCACGAGGGCTAAGGGCATCATTGCCATCTGCTGGGTGCTGTCGTTTGCCATCGGCCTGACTCCCATGCTAGGTTGGAACAACTGCGGTCAGCCAAAGGAGGGCAAGAACCACTCCCAGGGCTGCGGGGAGGGCCAAGTGGCCTGTCTCTTTGAGGATGTGGTCCCCATGAACTACATGGTGTACTTCAACTTCTTTGCCTGTGTGCTGGTGCCCCTGCTGCTCATGCTGGGTGTCTATTTGCGGATCTTCCTGGCGGCGCGACGACAGCTGAAGCAGATGGAGAGCCAGCCTCTGCCGGGGGAGCGGGCACGGTCCACACTGCAGAAGGAGGTCCATGCTGCCAAGTCACTGGCCATCATTGTGGGGCTCTTTGCCCTCTGCTGGCTGCCCCTACACATCATCAACTGCTTCACTTTCTTCTGCCCCGACTGCAGCCACGCCCCTCTCTGGCTCATGTACCTGGCCATCGTCCTCTCCCACACCAATTCGGTTGTGAATCCCTTCATCTACGCCTACCGTATCCGCGAGTTCCGCCAGACCTTCCGCAAGATCATTCGCAGCCACGTCCTGAGGCAGCAAGAACCTTTCAAGGCAGCTGGCACCAGTGCCCGGGTCTTGGCAGCTCATGGCAGTGACGGAGAGCAGGTCAGCCTCCGTCTCAACGGCCACCCGCCAGGAGTGTGGGCCAACGGCAGTGCTCCCCACCCTGAGCGGAGGCCCAATGGCTATGCCCTGGGGCTGGTGAGTGGAGGGAGTGCCCAAGAGTCCCAGGGGAACACGGGCCTCCCAGACGTGGAGCTCCTTAGCCATGAGCTCAAGGGAGTGTGCCCAGAGCCCCCTGGCCTAGATGACCCCCTGGCCCAGGATGGAGCAGGAGTGTCCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T77365-Ab | Anti-AA2AR/ ADORA2A/ A2aR monoclonal antibody |
Target Antigen | GM-Tg-g-T77365-Ag | ADORA2A VLP (virus-like particle) |
ORF Viral Vector | pGMAAV000023 | Human ADORA2A Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMAAV000313 | Human ADORA2A Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMAAV001052 | Human ADORA2A Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMAP000328 | Human ADORA2A Adenovirus plasmid |
ORF Viral Vector | vGMAAV000023 | Human ADORA2A Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMAAV000313 | Human ADORA2A Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMAAV001052 | Human ADORA2A Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMAP000328 | Human ADORA2A Adenovirus particle |
Target information
Target ID | GM-T77365 |
Target Name | ADORA2A |
Gene ID | 135, 11540, 707865, 25369, 101080742, 403960, 617828, 100034039 |
Gene Symbol and Synonyms | A2AAR,A2aR,AA2AR,ADENO,ADORA2,ADORA2A,Adora2l1,ARA2A,RDC8 |
Uniprot Accession | P29274 |
Uniprot Entry Name | AA2AR_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Immuno-oncology Target |
Disease | Not Available |
Gene Ensembl | ENSG00000128271 |
Target Classification | Checkpoint-Immuno Oncology |
This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor (GPCR) superfamily, which is subdivided into classes and subtypes. The receptors are seven-pass transmembrane proteins that respond to extracellular cues and activate intracellular signal transduction pathways. This protein, an adenosine receptor of A2A subtype, uses adenosine as the preferred endogenous agonist and preferentially interacts with the G(s) and G(olf) family of G proteins to increase intracellular cAMP levels. It plays an important role in many biological functions, such as cardiac rhythm and circulation, cerebral and renal blood flow, immune function, pain regulation, and sleep. It has been implicated in pathophysiological conditions such as inflammatory diseases and neurodegenerative disorders. Alternative splicing results in multiple transcript variants. A read-through transcript composed of the upstream SPECC1L (sperm antigen with calponin homology and coiled-coil domains 1-like) and ADORA2A (adenosine A2a receptor) gene sequence has been identified, but it is thought to be non-coding. [provided by RefSeq, Jun 2013]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.