Human LRAT/LCA14 ORF/cDNA clone-Adeno-associate virus(AAV) plasmid (NM_004744.4)
Cat. No.: pGMAAV001537
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human LRAT/LCA14 Adeno-associated virus expression plasmid (ITR-vector) for LRAT AAV packaging, LRAT AAV production.The purified Human LRAT/LCA14 AAV particle serves as an invaluable asset for in-depth in vivo LRAT studies, mechanism of action (MOA) research, and the evolution of LRAT-associated gene therapy strategies.
Our GM-AAV ITR vector is optimized with the G-NEXT™ multi-serotypes AAV vector system. Explore the G-NEXT™ system in detail.
Go to
LRAT/LCA14 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMAAV001537 |
Gene Name | LRAT |
Accession Number | NM_004744.4 |
Gene ID | 9227 |
Species | Human |
Product Type | Adeno-associate virus(AAV) plasmid (overexpression) |
Insert Length | 693 bp |
Gene Alias | LCA14 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Null |
Fusion Tag | 1xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGAAGAACCCCATGCTGGAGGTGGTGTCTTTACTACTGGAGAAGCTGCTCCTCATCTCCAACTTCACGCTCTTTAGTTCGGGCGCCGCGGGCGAAGACAAAGGGAGGAACAGTTTTTATGAAACCAGCTCTTTCCACCGAGGCGACGTGCTGGAGGTGCCCCGGACCCACCTGACCCACTATGGCATCTACCTAGGAGACAACCGTGTTGCCCACATGATGCCCGACATCCTGTTGGCCCTGACAGACGACATGGGGCGCACGCAGAAGGTGGTCTCCAACAAGCGTCTCATCCTGGGCGTTATTGTCAAAGTGGCCAGCATCCGCGTGGACACAGTGGAGGACTTCGCCTACGGAGCTAACATCCTGGTCAATCACCTGGACGAGTCCCTCCAGAAAAAGGCACTGCTCAACGAGGAGGTGGCGCGGAGGGCTGAAAAGCTGCTGGGCTTTACCCCCTACAGCCTGCTGTGGAACAACTGCGAGCACTTCGTGACCTACTGCAGATATGGCACCCCGATCAGTCCCCAGTCCGACAAGTTTTGTGAGACTGTGAAGATAATTATTCGTGATCAGAGAAGTGTTCTTGCTTCAGCAGTCTTGGGATTGGCGTCTATAGTCTGTACGGGCTTGGTATCATACACTACCCTTCCTGCAATTTTTATTCCATTCTTCCTATGGATGGCTGGCTAA |
ORF Protein Sequence | MKNPMLEVVSLLLEKLLLISNFTLFSSGAAGEDKGRNSFYETSSFHRGDVLEVPRTHLTHYGIYLGDNRVAHMMPDILLALTDDMGRTQKVVSNKRLILGVIVKVASIRVDTVEDFAYGANILVNHLDESLQKKALLNEEVARRAEKLLGFTPYSLLWNNCEHFVTYCRYGTPISPQSDKFCETVKIIIRDQRSVLASAVLGLASIVCTGLVSYTTLPAIFIPFFLWMAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP1105-Ab | Anti-LRAT monoclonal antibody |
Target Antigen | GM-Tg-g-IP1105-Ag | LRAT protein |
ORF Viral Vector | pGMLP000561 | Human LRAT Lentivirus plasmid |
ORF Viral Vector | pGMAAV001537 | Human LRAT Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMAAV001538 | Human LRAT Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | vGMLP000561 | Human LRAT Lentivirus particle |
ORF Viral Vector | vGMAAV001537 | Human LRAT Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMAAV001538 | Human LRAT Adeno-associate virus(AAV) particle |
Target information
Target ID | GM-IP1105 |
Target Name | LRAT |
Gene ID | 9227, 79235, 698871, 64047, 101092432, 482660, 281285, 100069704 |
Gene Symbol and Synonyms | 1300010A18Rik,LCA14,LRAT |
Uniprot Accession | O95237 |
Uniprot Entry Name | LRAT_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000121207 |
Target Classification | Not Available |
The protein encoded by this gene localizes to the endoplasmic reticulum, where it catalyzes the esterification of all-trans-retinol into all-trans-retinyl ester. This reaction is an important step in vitamin A metabolism in the visual system. Mutations in this gene have been associated with early-onset severe retinal dystrophy and Leber congenital amaurosis 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.