Human LRAT/LCA14 ORF/cDNA clone-Adeno-associate virus(AAV) particle (NM_004744.4)

Cat. No.: vGMAAV001538

Pre-made Human LRAT/LCA14 Adeno-associated virus particle for LRAT in-vivo study, mechanism of action (MOA) research and LRAT-associated gene therapy development.

At GM Vector Core (GMVC), we stand at the forefront of custom AAV development and produce distinct grades of AAVs employing state-of-the-art methodologies. Uncover more about our expertise.

Target products collection

Go to LRAT/LCA14 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name AAV serotype AAV Grade AAV quantity
vGMAAV001538 Human LRAT Adeno-associate virus(AAV) particle AAV1, AAV2, AAV2 variant (Y444F), AAV2 variant (Y272F, Y444F, Y500F, Y730F), AAV2 variant (Y444F, Y730F, Y500F, Y272F, Y704F, Y252F), AAV2 variant(AAV2.7m8), AAV5, AAV6, AAV8, AAV8-1m, AAV8-2m, AAV8 variant (Y733F, Y447F, Y275), AAV9, AAV-Rh.10, AAV-DJ, AAV-DJ/8, AAV-Retro (Retrograde), AAV9-PHP.B, AAV9-PHP.eB, AAV9-PHP.S, AAV-BR1, AAV-2i8, AAV-SIG, AAV-VEC, AAV4, AAV6.2, AAV6.2FF Pilot Grade 1.0E+12VG/ml
5.0E+12VG/ml
1E+13VG/ml
5E+13VG/ml
1E+14VG/ml
Research Grade 1.0E+12VG/ml
5.0E+12VG/ml
1E+13VG/ml
5E+13VG/ml
1E+14VG/ml
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAAV001538
Gene Name LRAT
Accession Number NM_004744.4
Gene ID 9227
Species Human
Product Type Adeno-associate virus(AAV) particle (overexpression)
Insert Length 693 bp
Gene Alias LCA14
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Null
Fusion Tag 1xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAGAACCCCATGCTGGAGGTGGTGTCTTTACTACTGGAGAAGCTGCTCCTCATCTCCAACTTCACGCTCTTTAGTTCGGGCGCCGCGGGCGAAGACAAAGGGAGGAACAGTTTTTATGAAACCAGCTCTTTCCACCGAGGCGACGTGCTGGAGGTGCCCCGGACCCACCTGACCCACTATGGCATCTACCTAGGAGACAACCGTGTTGCCCACATGATGCCCGACATCCTGTTGGCCCTGACAGACGACATGGGGCGCACGCAGAAGGTGGTCTCCAACAAGCGTCTCATCCTGGGCGTTATTGTCAAAGTGGCCAGCATCCGCGTGGACACAGTGGAGGACTTCGCCTACGGAGCTAACATCCTGGTCAATCACCTGGACGAGTCCCTCCAGAAAAAGGCACTGCTCAACGAGGAGGTGGCGCGGAGGGCTGAAAAGCTGCTGGGCTTTACCCCCTACAGCCTGCTGTGGAACAACTGCGAGCACTTCGTGACCTACTGCAGATATGGCACCCCGATCAGTCCCCAGTCCGACAAGTTTTGTGAGACTGTGAAGATAATTATTCGTGATCAGAGAAGTGTTCTTGCTTCAGCAGTCTTGGGATTGGCGTCTATAGTCTGTACGGGCTTGGTATCATACACTACCCTTCCTGCAATTTTTATTCCATTCTTCCTATGGATGGCTGGCTAA
ORF Protein Sequence MKNPMLEVVSLLLEKLLLISNFTLFSSGAAGEDKGRNSFYETSSFHRGDVLEVPRTHLTHYGIYLGDNRVAHMMPDILLALTDDMGRTQKVVSNKRLILGVIVKVASIRVDTVEDFAYGANILVNHLDESLQKKALLNEEVARRAEKLLGFTPYSLLWNNCEHFVTYCRYGTPISPQSDKFCETVKIIIRDQRSVLASAVLGLASIVCTGLVSYTTLPAIFIPFFLWMAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1105-Ab Anti-LRAT monoclonal antibody
    Target Antigen GM-Tg-g-IP1105-Ag LRAT protein
    ORF Viral Vector pGMLP000561 Human LRAT Lentivirus plasmid
    ORF Viral Vector pGMAAV001537 Human LRAT Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV001538 Human LRAT Adeno-associate virus(AAV) plasmid
    ORF Viral Vector vGMLP000561 Human LRAT Lentivirus particle
    ORF Viral Vector vGMAAV001537 Human LRAT Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV001538 Human LRAT Adeno-associate virus(AAV) particle


    Target information

    Target ID GM-IP1105
    Target Name LRAT
    Gene ID 9227, 79235, 698871, 64047, 101092432, 482660, 281285, 100069704
    Gene Symbol and Synonyms 1300010A18Rik,LCA14,LRAT
    Uniprot Accession O95237
    Uniprot Entry Name LRAT_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000121207
    Target Classification Not Available

    The protein encoded by this gene localizes to the endoplasmic reticulum, where it catalyzes the esterification of all-trans-retinol into all-trans-retinyl ester. This reaction is an important step in vitamin A metabolism in the visual system. Mutations in this gene have been associated with early-onset severe retinal dystrophy and Leber congenital amaurosis 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.