Human ADRB3/BETA3AR ORF/cDNA clone-Adenovirus plasmid (NM_000025)
Cat. No.: pGMAD000001
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human ADRB3/BETA3AR adenoviral expression plasmid for ADRB3 adenovirus packaging, ADRB3 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go to
ADRB3/BETA3AR products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMAD000001 |
Gene Name | ADRB3 |
Accession Number | NM_000025 |
Gene ID | 155 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 1227 bp |
Gene Alias | BETA3AR |
Fluorescent Reporter | Null |
Mammalian Cell Selection | Null |
Fusion Tag | Null |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCTCCGTGGCCTCACGAGAACAGCTCTCTTGCCCCATGGCCGGACCTCCCCACCCTGGCGCCCAATACCGCCAACACCAGTGGGCTGCCAGGGGTTCCGTGGGAGGCGGCCCTAGCCGGGGCCCTGCTGGCGCTGGCGGTGCTGGCCACCGTGGGAGGCAACCTGCTGGTCATCGTGGCCATCGCCTGGACTCCGAGACTCCAGACCATGACCAACGTGTTCGTGACTTCGCTGGCCGCAGCCGACCTGGTGATGGGACTCCTGGTGGTGCCGCCGGCGGCCACCTTGGCGCTGACTGGCCACTGGCCGTTGGGCGCCACTGGCTGCGAGCTGTGGACCTCGGTGGACGTGCTGTGTGTGACCGCCAGCATCGAAACCCTGTGCGCCCTGGCCGTGGACCGCTACCTGGCTGTGACCAACCCGCTGCGTTACGGCGCACTGGTCACCAAGCGCTGCGCCCGGACAGCTGTGGTCCTGGTGTGGGTCGTGTCGGCCGCGGTGTCGTTTGCGCCCATCATGAGCCAGTGGTGGCGCGTAGGGGCCGACGCCGAGGCGCAGCGCTGCCACTCCAACCCGCGCTGCTGTGCCTTCGCCTCCAACATGCCCTACGTGCTGCTGTCCTCCTCCGTCTCCTTCTACCTTCCTCTTCTCGTGATGCTCTTCGTCTACGCGCGGGTTTTCGTGGTGGCTACGCGCCAGCTGCGCTTGCTGCGCGGGGAGCTGGGCCGCTTTCCGCCCGAGGAGTCTCCGCCGGCGCCGTCGCGCTCTCTGGCCCCGGCCCCGGTGGGGACGTGCGCTCCGCCCGAAGGGGTGCCCGCCTGCGGCCGGCGGCCCGCGCGCCTCCTGCCTCTCCGGGAACACCGGGCCCTGTGCACCTTGGGTCTCATCATGGGCACCTTCACTCTCTGCTGGTTGCCCTTCTTTCTGGCCAACGTGCTGCGCGCCCTGGGGGGCCCCTCTCTAGTCCCGGGCCCGGCTTTCCTTGCCCTGAACTGGCTAGGTTATGCCAATTCTGCCTTCAACCCGCTCATCTACTGCCGCAGCCCGGACTTTCGCAGCGCCTTCCGCCGTCTTCTGTGCCGCTGCGGCCGTCGCCTGCCTCCGGAGCCCTGCGCCGCCGCCCGCCCGGCCCTCTTCCCCTCGGGCGTTCCTGCGGCCCGGAGCAGCCCAGCGCAGCCCAGGCTTTGCCAACGGCTCGACGGGGCTTCTTGGGGAGTTTCTTAG |
ORF Protein Sequence | MAPWPHENSSLAPWPDLPTLAPNTANTSGLPGVPWEAALAGALLALAVLATVGGNLLVIVAIAWTPRLQTMTNVFVTSLAAADLVMGLLVVPPAATLALTGHWPLGATGCELWTSVDVLCVTASIETLCALAVDRYLAVTNPLRYGALVTKRCARTAVVLVWVVSAAVSFAPIMSQWWRVGADAEAQRCHSNPRCCAFASNMPYVLLSSSVSFYLPLLVMLFVYARVFVVATRQLRLLRGELGRFPPEESPPAPSRSLAPAPVGTCAPPEGVPACGRRPARLLPLREHRALCTLGLIMGTFTLCWLPFFLANVLRALGGPSLVPGPAFLALNWLGYANSAFNPLIYCRSPDFRSAFRRLLCRCGRRLPPEPCAAARPALFPSGVPAARSSPAQPRLCQRLDGASWGVS |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T51408-Ab | Anti-ADRB3/ BETA3AR monoclonal antibody |
Target Antigen | GM-Tg-g-T51408-Ag | ADRB3 VLP (virus-like particle) |
ORF Viral Vector | pGMAD000001 | Human ADRB3 Adenovirus plasmid |
ORF Viral Vector | vGMAD000001 | Human ADRB3 Adenovirus particle |
Target information
Target ID | GM-T51408 |
Target Name | ADRB3 |
Gene ID | 155, 11556, 699129, 25645, 493930, 442979, 281606, 100147322 |
Gene Symbol and Synonyms | ADRB,Adrb-3,ADRB3,B3AR,BAR3,beta 3-AR,BETA3AR,GPCR |
Uniprot Accession | P13945 |
Uniprot Entry Name | ADRB3_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000188778 |
Target Classification | GPCR |
The protein encoded by this gene belongs to the family of beta adrenergic receptors, which mediate catecholamine-induced activation of adenylate cyclase through the action of G proteins. This receptor is located mainly in the adipose tissue and is involved in the regulation of lipolysis and thermogenesis. Obesity and bodyweight-related disorders are correlated with certain polymorphisms in three subtypes of beta-adrenoceptor, among them, the ADRB3 gene.[provided by RefSeq, Oct 2019]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.