Human BMP2/BDA2/ BMP2A ORF/cDNA clone-Adenovirus plasmid (NM_001200.4)

Pre-made Human BMP2/BDA2/ BMP2A adenoviral expression plasmid for BMP2 adenovirus packaging, BMP2 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to BMP2/BDA2 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAD000553 Human BMP2 Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAD000553
Gene Name BMP2
Accession Number NM_001200.4
Gene ID 650
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 1191 bp
Gene Alias BDA2, BMP2A, SSFSC
Fluorescent Reporter EGFP
Mammalian Cell Selection
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGTGGCCGGGACCCGCTGTCTTCTAGCGTTGCTGCTTCCCCAGGTCCTCCTGGGCGGCGCGGCTGGCCTCGTTCCGGAGCTGGGCCGCAGGAAGTTCGCGGCGGCGTCGTCGGGCCGCCCCTCATCCCAGCCCTCTGACGAGGTCCTGAGCGAGTTCGAGTTGCGGCTGCTCAGCATGTTCGGCCTGAAACAGAGACCCACCCCCAGCAGGGACGCCGTGGTGCCCCCCTACATGCTAGACCTGTATCGCAGGCACTCAGGTCAGCCGGGCTCACCCGCCCCAGACCACCGGTTGGAGAGGGCAGCCAGCCGAGCCAACACTGTGCGCAGCTTCCACCATGAAGAATCTTTGGAAGAACTACCAGAAACGAGTGGGAAAACAACCCGGAGATTCTTCTTTAATTTAAGTTCTATCCCCACGGAGGAGTTTATCACCTCAGCAGAGCTTCAGGTTTTCCGAGAACAGATGCAAGATGCTTTAGGAAACAATAGCAGTTTCCATCACCGAATTAATATTTATGAAATCATAAAACCTGCAACAGCCAACTCGAAATTCCCCGTGACCAGACTTTTGGACACCAGGTTGGTGAATCAGAATGCAAGCAGGTGGGAAAGTTTTGATGTCACCCCCGCTGTGATGCGGTGGACTGCACAGGGACACGCCAACCATGGATTCGTGGTGGAAGTGGCCCACTTGGAGGAGAAACAAGGTGTCTCCAAGAGACATGTTAGGATAAGCAGGTCTTTGCACCAAGATGAACACAGCTGGTCACAGATAAGGCCATTGCTAGTAACTTTTGGCCATGATGGAAAAGGGCATCCTCTCCACAAAAGAGAAAAACGTCAAGCCAAACACAAACAGCGGAAACGCCTTAAGTCCAGCTGTAAGAGACACCCTTTGTACGTGGACTTCAGTGACGTGGGGTGGAATGACTGGATTGTGGCTCCCCCGGGGTATCACGCCTTTTACTGCCACGGAGAATGCCCTTTTCCTCTGGCTGATCATCTGAACTCCACTAATCATGCCATTGTTCAGACGTTGGTCAACTCTGTTAACTCTAAGATTCCTAAGGCATGCTGTGTCCCGACAGAACTCAGTGCTATCTCGATGCTGTACCTTGACGAGAATGAAAAGGTTGTATTAAAGAACTATCAGGACATGGTTGTGGAGGGTTGTGGGTGTCGCTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T68383-Ab Anti-BMP2/ BDA2A/ SSFSC monoclonal antibody
    Target Antigen GM-Tg-g-T68383-Ag BMP2 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T68383 bone morphogenetic protein 2 (BMP2) protein & antibody
    ORF Viral Vector pGMAD000286 Rat Bmp2 Adenovirus plasmid
    ORF Viral Vector pGMAD000553 Human BMP2 Adenovirus plasmid
    ORF Viral Vector pGMAAV000460 Human BMP2 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMPC001201 Human BMP2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP002836 Human BMP2 Lentivirus plasmid
    ORF Viral Vector pGMLP-SPh-068 Human BMP2 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-208 Human BMP2 Adenovirus plasmid
    ORF Viral Vector vGMAD000286 Rat Bmp2 Adenovirus particle
    ORF Viral Vector vGMAD000553 Human BMP2 Adenovirus particle
    ORF Viral Vector vGMAAV000460 Human BMP2 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMLP002836 Human BMP2 Lentivirus particle
    ORF Viral Vector vGMLP-SPh-068 Human BMP2 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-208 Human BMP2 Adenovirus particle


    Target information

    Target ID GM-T68383
    Target Name BMP2
    Gene ID 650, 12156, 718330, 29373, 100301987, 477162, 615037, 100051701
    Gene Symbol and Synonyms BDA2,BMP2,BMP2A,SSFSC,SSFSC1
    Uniprot Accession P12643
    Uniprot Entry Name BMP2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000125845
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer, which plays a role in bone and cartilage development. Duplication of a regulatory region downstream of this gene causes a form of brachydactyly characterized by a malformed index finger and second toe in human patients. [provided by RefSeq, Jul 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.