Human CMTM6/CKLFSF6/PRO2219 ORF/cDNA clone-Adenovirus plasmid (NM_017801)

Cat. No.: pGMAD000802
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CMTM6/CKLFSF6/PRO2219 adenoviral expression plasmid for CMTM6 adenovirus packaging, CMTM6 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.


Target products collection

Go to CMTM6/CKLFSF6 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAD000802
Gene Name CMTM6
Accession Number NM_017801
Gene ID 54918
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 552 bp
Gene Alias CKLFSF6,PRO2219
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGGAGAACGGAGCGGTGTACAGCCCCACTACGGAGGAGGACCCGGGCCCCGCCAGAGGCCCCCGGAGCGGCCTCGCTGCCTACTTTTTCATGGGCCGGCTCCCATTGCTCCGGCGCGTTCTCAAGGGCTTGCAGCTGTTGCTGTCTCTGCTGGCCTTCATCTGTGAAGAAGTTGTATCACAATGTACTTTATGTGGAGGACTTTATTTTTTTGAGTTTGTAAGCTGCAGTGCCTTTCTTCTGAGTCTCCTTATACTGATTGTGTATTGCACTCCATTTTATGAGAGAGTTGATACCACAAAAGTAAAATCATCGGATTTTTATATTACTTTGGGAACAGGATGTGTGTTTTTGTTGGCATCCATCATTTTTGTTTCCACACATGACAGGACTTCAGCTGAGATTGCTGCAATTGTGTTTGGATTTATAGCAAGTTTTATGTTCCTACTTGACTTTATCACTATGCTGTATGAAAAACGACAGGAGTCCCAGCTGAGAAAACCTGAAAATACCACTAGGGCTGAAGCCCTCACTGAGCCACTTAATGCCTAA
ORF Protein Sequence MENGAVYSPTTEEDPGPARGPRSGLAAYFFMGRLPLLRRVLKGLQLLLSLLAFICEEVVSQCTLCGGLYFFEFVSCSAFLLSLLILIVYCTPFYERVDTTKVKSSDFYITLGTGCVFLLASIIFVSTHDRTSAEIAAIVFGFIASFMFLLDFITMLYEKRQESQLRKPENTTRAEALTEPLNA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0308-Ab Anti-CKLF6/ CMTM6/ CKLFSF6 monoclonal antibody
    Target Antigen GM-Tg-g-MP0308-Ag CMTM6 VLP (virus-like particle)
    ORF Viral Vector pGMLP000070 Human CMTM6 Lentivirus plasmid
    ORF Viral Vector pGMAD000802 Human CMTM6 Adenovirus plasmid
    ORF Viral Vector vGMLP000070 Human CMTM6 Lentivirus particle
    ORF Viral Vector vGMAD000802 Human CMTM6 Adenovirus particle


    Target information

    Target ID GM-MP0308
    Target Name CMTM6
    Gene ID 54918, 67213, 704441, 316035, 101081491, 609718, 508881, 100630157
    Gene Symbol and Synonyms 2810051A14Rik,CKLFSF6,CMTM6,Da2-17,LRRGT00102,PRO2219
    Uniprot Accession Q9NX76
    Uniprot Entry Name CKLF6_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000091317
    Target Classification Not Available

    This gene belongs to the chemokine-like factor gene superfamily, a novel family that is similar to the chemokine and transmembrane 4 superfamilies. This gene is one of several chemokine-like factor genes located in a cluster on chromosome 3. This gene is widely expressed in many tissues, but the exact function of the encoded protein is unknown. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.