Human CMTM6/CKLFSF6/PRO2219 ORF/cDNA clone-Adenovirus particle (NM_017801)

Cat. No.: vGMAD000802

Pre-made Human CMTM6/CKLFSF6/PRO2219 Adenovirus for CMTM6 overexpression in-vitro and in-vivo. The CMTM6 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified CMTM6-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to CMTM6/CKLFSF6 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAD000802 Human CMTM6 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAD000802
Gene Name CMTM6
Accession Number NM_017801
Gene ID 54918
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 552 bp
Gene Alias CKLFSF6,PRO2219
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGGAGAACGGAGCGGTGTACAGCCCCACTACGGAGGAGGACCCGGGCCCCGCCAGAGGCCCCCGGAGCGGCCTCGCTGCCTACTTTTTCATGGGCCGGCTCCCATTGCTCCGGCGCGTTCTCAAGGGCTTGCAGCTGTTGCTGTCTCTGCTGGCCTTCATCTGTGAAGAAGTTGTATCACAATGTACTTTATGTGGAGGACTTTATTTTTTTGAGTTTGTAAGCTGCAGTGCCTTTCTTCTGAGTCTCCTTATACTGATTGTGTATTGCACTCCATTTTATGAGAGAGTTGATACCACAAAAGTAAAATCATCGGATTTTTATATTACTTTGGGAACAGGATGTGTGTTTTTGTTGGCATCCATCATTTTTGTTTCCACACATGACAGGACTTCAGCTGAGATTGCTGCAATTGTGTTTGGATTTATAGCAAGTTTTATGTTCCTACTTGACTTTATCACTATGCTGTATGAAAAACGACAGGAGTCCCAGCTGAGAAAACCTGAAAATACCACTAGGGCTGAAGCCCTCACTGAGCCACTTAATGCCTAA
ORF Protein Sequence MENGAVYSPTTEEDPGPARGPRSGLAAYFFMGRLPLLRRVLKGLQLLLSLLAFICEEVVSQCTLCGGLYFFEFVSCSAFLLSLLILIVYCTPFYERVDTTKVKSSDFYITLGTGCVFLLASIIFVSTHDRTSAEIAAIVFGFIASFMFLLDFITMLYEKRQESQLRKPENTTRAEALTEPLNA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0308-Ab Anti-CKLF6/ CMTM6/ CKLFSF6 monoclonal antibody
    Target Antigen GM-Tg-g-MP0308-Ag CMTM6 VLP (virus-like particle)
    ORF Viral Vector pGMLP000070 Human CMTM6 Lentivirus plasmid
    ORF Viral Vector pGMAD000802 Human CMTM6 Adenovirus plasmid
    ORF Viral Vector vGMLP000070 Human CMTM6 Lentivirus particle
    ORF Viral Vector vGMAD000802 Human CMTM6 Adenovirus particle


    Target information

    Target ID GM-MP0308
    Target Name CMTM6
    Gene ID 54918, 67213, 704441, 316035, 101081491, 609718, 508881, 100630157
    Gene Symbol and Synonyms 2810051A14Rik,CKLFSF6,CMTM6,Da2-17,LRRGT00102,PRO2219
    Uniprot Accession Q9NX76
    Uniprot Entry Name CKLF6_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000091317
    Target Classification Not Available

    This gene belongs to the chemokine-like factor gene superfamily, a novel family that is similar to the chemokine and transmembrane 4 superfamilies. This gene is one of several chemokine-like factor genes located in a cluster on chromosome 3. This gene is widely expressed in many tissues, but the exact function of the encoded protein is unknown. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.